BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBS5e09.xg.2.1
(723 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF620291.2|BF620291 HVSMEc0019F18f Hordeum vulgare seedl... 46 0.002
gb|BF257303.2|BF257303 HVSMEf0012H19f Hordeum vulgare seedl... 46 0.002
gb|BM371070.2|BM371070 EBro04_SQ003_G10_R root, 3 week, sal... 46 0.002
gb|CA009114.1|CA009114 HU13D11r HU Hordeum vulgare subsp. v... 44 0.006
gb|BF256192.2|BF256192 HVSMEf0009B02f Hordeum vulgare seedl... 40 0.098
gb|AJ462135.1|AJ462135 AJ462135 S00002 Hordeum vulgare subs... 38 0.39
gb|CA011277.1|CA011277 HT05P21u HT Hordeum vulgare subsp. v... 38 0.39
gb|CA012635.1|CA012635 HT05P21r HT Hordeum vulgare subsp. v... 38 0.39
>gb|BF620291.2|BF620291 HVSMEc0019F18f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0019F18f, mRNA sequence
Length = 689
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 265 gtgctgtacgtgagcttcggcag 287
|||||||||||||||||||||||
Sbjct: 404 gtgctgtacgtgagcttcggcag 426
Score = 38.2 bits (19), Expect = 0.39
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 457 tgggcgccgcagcaggaggtgct 479
|||||||||||| ||||||||||
Sbjct: 596 tgggcgccgcaggaggaggtgct 618
>gb|BF257303.2|BF257303 HVSMEf0012H19f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0012H19f, mRNA sequence
Length = 847
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 265 gtgctgtacgtgagcttcggcag 287
|||||||||||||||||||||||
Sbjct: 204 gtgctgtacgtgagcttcggcag 226
Score = 38.2 bits (19), Expect = 0.39
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 457 tgggcgccgcagcaggaggtgct 479
|||||||||||| ||||||||||
Sbjct: 396 tgggcgccgcaggaggaggtgct 418
>gb|BM371070.2|BM371070 EBro04_SQ003_G10_R root, 3 week, salt-stressed, cv Optic, EBro04
Hordeum vulgare subsp. vulgare cDNA clone
EBro04_SQ003_G10 5', mRNA sequence
Length = 365
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 265 gtgctgtacgtgagcttcggcag 287
|||||||||||||||||||||||
Sbjct: 306 gtgctgtacgtgagcttcggcag 328
>gb|CA009114.1|CA009114 HU13D11r HU Hordeum vulgare subsp. vulgare cDNA clone HU13D11
5-PRIME, mRNA sequence
Length = 581
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 262 tccgtgctgtacgtgagcttcggcag 287
|||||| |||||||||||||||||||
Sbjct: 92 tccgtggtgtacgtgagcttcggcag 117
>gb|BF256192.2|BF256192 HVSMEf0009B02f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0009B02f, mRNA sequence
Length = 782
Score = 40.1 bits (20), Expect = 0.098
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 456 gtgggcgccgcagcaggaggtgct 479
|||||||||||||| |||||||||
Sbjct: 40 gtgggcgccgcagcgggaggtgct 63
>gb|AJ462135.1|AJ462135 AJ462135 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200058E12F1, mRNA sequence
Length = 360
Score = 38.2 bits (19), Expect = 0.39
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 457 tgggcgccgcagcaggaggtgct 479
|||||||||||| ||||||||||
Sbjct: 29 tgggcgccgcaggaggaggtgct 51
>gb|CA011277.1|CA011277 HT05P21u HT Hordeum vulgare subsp. vulgare cDNA clone HT05P21
3-PRIME, mRNA sequence
Length = 508
Score = 38.2 bits (19), Expect = 0.39
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 145 ttcgccgtcggcccgcttcacaagctc 171
|||| |||||||||||| |||||||||
Sbjct: 419 ttcgacgtcggcccgctccacaagctc 393
>gb|CA012635.1|CA012635 HT05P21r HT Hordeum vulgare subsp. vulgare cDNA clone HT05P21
5-PRIME, mRNA sequence
Length = 500
Score = 38.2 bits (19), Expect = 0.39
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 145 ttcgccgtcggcccgcttcacaagctc 171
|||| |||||||||||| |||||||||
Sbjct: 326 ttcgacgtcggcccgctccacaagctc 352
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 72,080
Number of Sequences: 312970
Number of extensions: 72080
Number of successful extensions: 20904
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20887
Number of HSP's gapped (non-prelim): 17
length of query: 723
length of database: 175,134,539
effective HSP length: 19
effective length of query: 704
effective length of database: 169,188,109
effective search space: 119108428736
effective search space used: 119108428736
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)