BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBB9c12.pg.2.1
         (545 letters)

Database: Hordeum_nucl_with_EST.fasta 
           312,970 sequences; 175,134,539 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BF622661.2|BF622661  HVSMEa0007K11f Hordeum vulgare seedl...    62   2e-008
gb|BF621553.2|BF621553  HVSMEa0011G05f Hordeum vulgare seedl...    60   8e-008
gb|CB859283.1|CB859283  HI09P17w HI Hordeum vulgare subsp. v...    52   2e-005
gb|BI947779.1|BI947779  HVSMEl0006O13f Hordeum vulgare spike...    46   0.001
gb|BQ765127.1|BQ765127  EBca01_SQ005_J21_R carpel, pre-anthe...    38   0.29 

>gb|BF622661.2|BF622661 HVSMEa0007K11f Hordeum vulgare seedling shoot EST library
           HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
           cDNA clone HVSMEa0007K11f, mRNA sequence
          Length = 697

 Score = 61.9 bits (31), Expect = 2e-008
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggagcttggcaatggattgtacaattctggcaaaccattcatttgggttgtgaggtcaaa 63
           ||||||||||||||| |||| ||||||| ||||||| ||  |||||||||| || || ||
Sbjct: 121 ggagcttggcaatggtttgtgcaattctagcaaaccttttctttgggttgtaagatccaa 180

                          
Query: 64  cgaagaacacaagtt 78
            || |||||||||||
Sbjct: 181 tgaggaacacaagtt 195




 Score = 60.0 bits (30), Expect = 8e-008
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                       
Query: 128 tggtgcccccagctggaagttctagcacataaagctacaggttgtttcttcacacattgc 187
           |||||||||||||| || ||||| |||||||  |||| |||||| ||| | || || || 
Sbjct: 245 tggtgcccccagcttgaggttcttgcacatagggctataggttgcttcattacccactgt 304

                                                 
Query: 188 ggatggaactcgacattggaagcaattgttaatggtgt 225
           ||||||||||| ||| | || ||| |||||||||||||
Sbjct: 305 ggatggaactcaacactagaggcacttgttaatggtgt 342



>gb|BF621553.2|BF621553 HVSMEa0011G05f Hordeum vulgare seedling shoot EST library
           HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
           cDNA clone HVSMEa0011G05f, mRNA sequence
          Length = 797

 Score = 60.0 bits (30), Expect = 8e-008
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                       
Query: 128 tggtgcccccagctggaagttctagcacataaagctacaggttgtttcttcacacattgc 187
           |||||||||||||| || ||||| |||||||  |||| |||||| ||| | || || || 
Sbjct: 63  tggtgcccccagcttgaggttcttgcacatagggctataggttgcttcgttacccactgt 122

                                                 
Query: 188 ggatggaactcgacattggaagcaattgttaatggtgt 225
           ||||||||||| ||| | || ||| |||||||||||||
Sbjct: 123 ggatggaactcaacactagaggcacttgttaatggtgt 160




 Score = 38.2 bits (19), Expect = 0.29
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 416 tggatgcaaaaggccaagg 434
           |||||||||||||||||||
Sbjct: 351 tggatgcaaaaggccaagg 369



>gb|CB859283.1|CB859283 HI09P17w HI Hordeum vulgare subsp. vulgare cDNA clone HI09P17
           3-PRIME, mRNA sequence
          Length = 560

 Score = 52.0 bits (26), Expect = 2e-005
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 317 gatgagaaaggcttggtaacgagggacgaggtggaaaggtgcatca 362
           ||||||||||| ||||| | |||||| |||||||| ||||||||||
Sbjct: 292 gatgagaaagggttggtgaggagggaggaggtggagaggtgcatca 337



>gb|BI947779.1|BI947779 HVSMEl0006O13f Hordeum vulgare spike EST library HVcDNA0012
           (Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
           clone HVSMEl0006O13f, mRNA sequence
          Length = 1003

 Score = 46.1 bits (23), Expect = 0.001
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 164 acaggttgtttcttcacacattgcggatggaactcgacattggaagcaattgtta 218
           |||||||||||||| || || || ||||||||||| |||   |||||||||||||
Sbjct: 19  acaggttgtttcttaactcactgtggatggaactctacaacagaagcaattgtta 73



>gb|BQ765127.1|BQ765127 EBca01_SQ005_J21_R carpel, pre-anthesis, no treatment, cv Optic,
           EBca01 Hordeum vulgare subsp. vulgare cDNA clone
           EBca01_SQ005_J21 5', mRNA sequence
          Length = 662

 Score = 38.2 bits (19), Expect = 0.29
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 366 atgtcatggatggtgatag 384
           |||||||||||||||||||
Sbjct: 87  atgtcatggatggtgatag 69



  Database: Hordeum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:16 PM
  Number of letters in database: 175,134,539
  Number of sequences in database:  312,970
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 41,363
Number of Sequences: 312970
Number of extensions: 41363
Number of successful extensions: 10227
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10215
Number of HSP's gapped (non-prelim): 12
length of query: 545
length of database: 175,134,539
effective HSP length: 19
effective length of query: 526
effective length of database: 169,188,109
effective search space: 88992945334
effective search space used: 88992945334
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)