BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF14f01.yg.2.1
(319 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU986456.1|BU986456 HF11O19r HF Hordeum vulgare subsp. v... 111 1e-023
gb|CA024809.1|CA024809 HZ50F23r HZ Hordeum vulgare subsp. v... 111 1e-023
gb|AV909171.1|AV909171 AV909171 K. Sato unpublished cDNA li... 46 7e-004
gb|AV911054.1|AV911054 AV911054 K. Sato unpublished cDNA li... 46 7e-004
gb|CA032787.1|CA032787 HX14D07r HX Hordeum vulgare subsp. v... 46 7e-004
gb|BJ544949.1|BJ544949 BJ544949 K. Sato unpublished cDNA li... 46 7e-004
gb|BJ546433.1|BJ546433 BJ546433 K. Sato unpublished cDNA li... 46 7e-004
gb|BJ549963.1|BJ549963 BJ549963 K. Sato unpublished cDNA li... 46 7e-004
gb|CB881764.1|CB881764 HM10N01w HM Hordeum vulgare subsp. v... 46 7e-004
>gb|BU986456.1|BU986456 HF11O19r HF Hordeum vulgare subsp. vulgare cDNA clone HF11O19
5-PRIME, mRNA sequence
Length = 478
Score = 111 bits (56), Expect = 1e-023
Identities = 83/93 (89%)
Strand = Plus / Minus
Query: 21 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 80
||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 164 cactgcagcaccacggataacctcagggctgatgcttggattatatccaagacccatcac 105
Query: 81 atgccatgacttatccannngcttggtattgcc 113
||||||||||||||| | |||| ||||||||
Sbjct: 104 atgccatgacttatcaagtggcttagtattgcc 72
>gb|CA024809.1|CA024809 HZ50F23r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ50F23
5-PRIME, mRNA sequence
Length = 154
Score = 111 bits (56), Expect = 1e-023
Identities = 83/93 (89%)
Strand = Plus / Minus
Query: 21 cactgcagcactacggattgcctcagggctgatgcttggattatagccaagacccattac 80
||||||||||| |||||| |||||||||||||||||| |||||| ||||||||||| ||
Sbjct: 114 cactgcagcaccacggataacctcagggctgatgcttgcattatatccaagacccatcac 55
Query: 81 atgccatgacttatccannngcttggtattgcc 113
||||||||||||||||| |||| ||||||||
Sbjct: 54 atgccatgacttatccagtggcttagtattgcc 22
>gb|AV909171.1|AV909171 AV909171 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak11o03 5', mRNA sequence
Length = 586
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 145 gctgatgcttggattatacccgagacccaggacatgcca 107
>gb|AV911054.1|AV911054 AV911054 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak11o03 3', mRNA sequence
Length = 527
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 383 gctgatgcttggattatacccgagacccaggacatgcca 421
>gb|CA032787.1|CA032787 HX14D07r HX Hordeum vulgare subsp. vulgare cDNA clone HX14D07
5-PRIME, mRNA sequence
Length = 529
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 394 gctgatgcttggattatacccgagacccaggacatgcca 356
>gb|BJ544949.1|BJ544949 BJ544949 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak41d13 5', mRNA sequence
Length = 589
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 148 gctgatgcttggattatacccgagacccaggacatgcca 110
>gb|BJ546433.1|BJ546433 BJ546433 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak41d13 3', mRNA sequence
Length = 525
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 382 gctgatgcttggattatacccgagacccaggacatgcca 420
>gb|BJ549963.1|BJ549963 BJ549963 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags25a14 3', mRNA sequence
Length = 625
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 384 gctgatgcttggattatacccgagacccaggacatgcca 422
>gb|CB881764.1|CB881764 HM10N01w HM Hordeum vulgare subsp. vulgare cDNA clone HM10N01
3-PRIME, mRNA sequence
Length = 535
Score = 46.1 bits (23), Expect = 7e-004
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 48 gctgatgcttggattatagccaagacccattacatgcca 86
|||||||||||||||||| || ||||||| ||||||||
Sbjct: 432 gctgatgcttggattatacccgagacccaggacatgcca 470
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 13,883
Number of Sequences: 312970
Number of extensions: 13883
Number of successful extensions: 3450
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 3441
Number of HSP's gapped (non-prelim): 9
length of query: 319
length of database: 175,134,539
effective HSP length: 18
effective length of query: 301
effective length of database: 169,501,079
effective search space: 51019824779
effective search space used: 51019824779
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)