BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF12e06.yg.2.1
         (561 letters)

Database: Hordeum_nucl_with_EST.fasta 
           312,970 sequences; 175,134,539 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AV834211.1|AV834211  AV834211 K. Sato unpublished cDNA li...    52   2e-005

>gb|AV834211.1|AV834211 AV834211 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
           vulgare shoots germination Hordeum vulgare subsp.
           vulgare cDNA clone bags7a24, mRNA sequence
          Length = 663

 Score = 52.0 bits (26), Expect = 2e-005
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 472 tgcactacaatggtgtgatgaaaccttggcttgacttggggatacttgattacaagaact 531
           ||||||||||||||   ||||||||||||||||| ||||| ||||   |||||| ||| |
Sbjct: 494 tgcactacaatggtaatatgaaaccttggcttgaattgggtataccaaattacaggaagt 435

                 
Query: 532 actgga 537
           ||||||
Sbjct: 434 actgga 429



  Database: Hordeum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:16 PM
  Number of letters in database: 175,134,539
  Number of sequences in database:  312,970
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 44,224
Number of Sequences: 312970
Number of extensions: 44224
Number of successful extensions: 12762
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12761
Number of HSP's gapped (non-prelim): 1
length of query: 561
length of database: 175,134,539
effective HSP length: 19
effective length of query: 542
effective length of database: 169,188,109
effective search space: 91699955078
effective search space used: 91699955078
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)