BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4573985.2.1
(373 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG418753.1|BG418753 HVSMEk0024E15f Hordeum vulgare testa... 234 2e-060
gb|BE455799.3|BE455799 HVSMEg0015D01f Hordeum vulgare pre-a... 234 2e-060
dbj|AB040769.1| Hordeum vulgare mRNA for endo-1,4-beta-gluc... 234 2e-060
gb|AL508501.1|AL508501 AL508501 Hordeum vulgare Barke devel... 226 4e-058
gb|CK123474.1|CK123474 BES1824104c11 BES1824 Hordeum vulgar... 226 4e-058
gb|AV925024.1|AV925024 AV925024 K. Sato unpublished cDNA li... 220 2e-056
gb|AV914894.1|AV914894 AV914894 K. Sato unpublished cDNA li... 212 6e-054
gb|AV914917.1|AV914917 AV914917 K. Sato unpublished cDNA li... 212 6e-054
gb|AV925017.1|AV925017 AV925017 K. Sato unpublished cDNA li... 174 1e-042
gb|AV925025.1|AV925025 AV925025 K. Sato unpublished cDNA li... 174 1e-042
gb|BU983204.1|BU983204 HA28O05r HA Hordeum vulgare subsp. v... 165 1e-039
gb|BG365744.1|BG365744 HVSMEi0004A10f Hordeum vulgare 20 DA... 147 3e-034
gb|AW982666.3|AW982666 HVSMEg0003O04f Hordeum vulgare pre-a... 147 3e-034
gb|BI776580.2|BI776580 EBpi07_SQ001_A20_R pistil, 12 DPA, n... 82 1e-014
gb|CA027952.1|CA027952 HZ60I16r HZ Hordeum vulgare subsp. v... 74 4e-012
gb|CA030964.1|CA030964 HX08K06r HX Hordeum vulgare subsp. v... 74 4e-012
gb|BI949643.1|BI949643 HVSMEl0015A22f Hordeum vulgare spike... 72 1e-011
gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, ... 52 1e-005
gb|BM371350.1|BM371350 EBma08_SQ002_G09_R maternal, 28 DPA,... 46 8e-004
gb|BM371364.1|BM371364 EBma08_SQ002_H03_R maternal, 28 DPA,... 46 8e-004
gb|BM371365.1|BM371365 EBma08_SQ002_H04_R maternal, 28 DPA,... 46 8e-004
gb|BM371395.1|BM371395 EBma08_SQ002_J02_R maternal, 28 DPA,... 46 8e-004
gb|BM371412.1|BM371412 EBma08_SQ002_K03_R maternal, 28 DPA,... 46 8e-004
gb|BM371462.1|BM371462 EBma08_SQ002_N04_R maternal, 28 DPA,... 46 8e-004
gb|BM376006.1|BM376006 EBma01_SQ002_B01_R maternal, 4 DPA, ... 46 8e-004
gb|BM376095.1|BM376095 EBma01_SQ002_F10_R maternal, 4 DPA, ... 46 8e-004
gb|BM376112.1|BM376112 EBma01_SQ002_G07_R maternal, 4 DPA, ... 46 8e-004
gb|BQ134680.1|BQ134680 LP30153 Lemma/palea-enriched cDNA li... 46 8e-004
gb|BM376096.2|BM376096 EBma01_SQ002_F11_R maternal, 4 DPA, ... 46 8e-004
gb|BM376175.2|BM376175 EBma01_SQ002_J04_R maternal, 4 DPA, ... 46 8e-004
gb|BM376199.2|BM376199 EBma01_SQ002_K09_R maternal, 4 DPA, ... 46 8e-004
gb|BM376260.2|BM376260 EBma01_SQ002_N09_R maternal, 4 DPA, ... 46 8e-004
gb|BM376261.2|BM376261 EBma01_SQ002_N10_R maternal, 4 DPA, ... 46 8e-004
gb|BM376262.2|BM376262 EBma01_SQ002_N11_R maternal, 4 DPA, ... 46 8e-004
gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA,... 46 8e-004
gb|BM371428.2|BM371428 EBma08_SQ002_L03_R maternal, 28 DPA,... 46 8e-004
gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, ... 44 0.003
gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA li... 44 0.003
gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA li... 44 0.003
gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA li... 44 0.003
gb|BQ294526.1|BQ294526 LP10283 Lemma/palea-enriched cDNA li... 44 0.003
gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, ... 44 0.003
gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA,... 44 0.003
gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA,... 44 0.003
gb|BQ758127.1|BQ758127 EBma01_SQ002_L08_R maternal, 4 DPA, ... 44 0.003
gb|BM371400.1|BM371400 EBma08_SQ002_J07_R maternal, 28 DPA,... 42 0.013
gb|BM371413.1|BM371413 EBma08_SQ002_K05_R maternal, 28 DPA,... 42 0.013
gb|BQ134691.1|BQ134691 LP30188 Lemma/palea-enriched cDNA li... 42 0.013
gb|BQ134696.1|BQ134696 LP20015 Lemma/palea-enriched cDNA li... 42 0.013
gb|BQ135350.1|BQ135350 LP10104 Lemma/palea-enriched cDNA li... 42 0.013
gb|BQ294513.1|BQ294513 LP10226 Lemma/palea-enriched cDNA li... 42 0.013
gb|BQ294528.1|BQ294528 LP10288 Lemma/palea-enriched cDNA li... 42 0.013
dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 42 0.013
gb|BI952568.1|BI952568 HVSMEm0007A04f Hordeum vulgare green... 40 0.050
gb|BQ762691.1|BQ762691 EBro02_SQ004_C20_R root, 3 week, hyd... 40 0.050
gb|AJ582221.1|AJ582221 AJ582221 Hordeum vulgare subsp. vulg... 38 0.20
>gb|BG418753.1|BG418753 HVSMEk0024E15f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0024E15f, mRNA sequence
Length = 879
Score = 234 bits (118), Expect = 2e-060
Identities = 279/332 (84%), Gaps = 3/332 (0%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 408 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 349
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 348 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 289
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 288 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 229
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 228 gc---atggggcctttagaggtgtcacccacgccaacctgggcgacgatccggtcgatgg 172
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagctcct 322
|||| || || || |||||||| ||||| |||||||| || ||||||||||| | |||||
Sbjct: 171 tgtcggcggacgagttgaaggtcttgagcatgtagtcggtgccccacttgatgatctcct 112
Query: 323 tgatatggtcgagctcaccgatggcctcgtac 354
||| |||||||||||| |||||||||||||||
Sbjct: 111 tgacatggtcgagctcgccgatggcctcgtac 80
>gb|BE455799.3|BE455799 HVSMEg0015D01f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0015D01f, mRNA sequence
Length = 578
Score = 234 bits (118), Expect = 2e-060
Identities = 279/332 (84%), Gaps = 3/332 (0%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 516 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 457
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 456 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 397
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 396 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 337
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 336 gc---atggggcctttagaggtgtcacccacgccaacctgggcgacgatccggtcgatgg 280
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagctcct 322
|||| || || || |||||||| ||||| |||||||| || ||||||||||| | |||||
Sbjct: 279 tgtcggcggacgagttgaaggtcttgagcatgtagtcggtgccccacttgatgatctcct 220
Query: 323 tgatatggtcgagctcaccgatggcctcgtac 354
||| |||||||||||| |||||||||||||||
Sbjct: 219 tgacatggtcgagctcgccgatggcctcgtac 188
>dbj|AB040769.1| Hordeum vulgare mRNA for endo-1,4-beta-glucanase Cel1, complete cds
Length = 2442
Score = 234 bits (118), Expect = 2e-060
Identities = 279/332 (84%), Gaps = 3/332 (0%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 1087 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 1028
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 1027 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 968
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 967 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 908
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 907 gc---atggggcctttagaggtgtcacccacgccgacctgggcgacgatccggtcgatgg 851
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagctcct 322
|||| || || || |||||||| ||||| |||||||| || ||||||||||| | |||||
Sbjct: 850 tgtcggcggacgagttgaaggtcttgagcatgtagtcggtgccccacttgatgatctcct 791
Query: 323 tgatatggtcgagctcaccgatggcctcgtac 354
||| |||||||||||| |||||||||||||||
Sbjct: 790 tgacatggtcgagctcgccgatggcctcgtac 759
>gb|AL508501.1|AL508501 AL508501 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY08P04V 5',
mRNA sequence
Length = 692
Score = 226 bits (114), Expect = 4e-058
Identities = 278/332 (83%), Gaps = 3/332 (0%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 535 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 476
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 475 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 416
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 415 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 356
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 355 gc---atggggcctttagaggtgtcacccacgccgacctgggcgacgatccggtcgatgg 299
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagctcct 322
|||| || || || || ||||| ||||| |||||||| || ||||||||||| | |||||
Sbjct: 298 tgtcggcggacgagttaaaggtcttgagcatgtagtcggtgccccacttgatgatctcct 239
Query: 323 tgatatggtcgagctcaccgatggcctcgtac 354
||| |||||||||||| |||||||||||||||
Sbjct: 238 tgacatggtcgagctcgccgatggcctcgtac 207
>gb|CK123474.1|CK123474 BES1824104c11 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010C114 5-PRIME, mRNA sequence
Length = 780
Score = 226 bits (114), Expect = 4e-058
Identities = 278/332 (83%), Gaps = 3/332 (0%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 635 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 576
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 575 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 516
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 515 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 456
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 455 gc---atggggcctttagaggtgtcacccacgccgacctgggcgacgatccggtcgatgg 399
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagctcct 322
|||| || || || || ||||| ||||| |||||||| || ||||||||||| | |||||
Sbjct: 398 tgtcggcggacgagttaaaggtcttgagcatgtagtcggtgccccacttgatgatctcct 339
Query: 323 tgatatggtcgagctcaccgatggcctcgtac 354
||| |||||||||||| |||||||||||||||
Sbjct: 338 tgacatggtcgagctcgccgatggcctcgtac 307
>gb|AV925024.1|AV925024 AV925024 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd17p11 5', mRNA sequence
Length = 639
Score = 220 bits (111), Expect = 2e-056
Identities = 260/309 (84%), Gaps = 3/309 (0%)
Strand = Plus / Minus
Query: 46 agcttgtcggagtaggttttgctgtccttgaacactatggaagctgcagccagggcagca 105
|||||||| ||||| | |||||||||||||||||||||||||| || || ||||| ||
Sbjct: 633 agcttgtcagagtacgccttgctgtccttgaacactatggaagccgcggcgagggcggcg 574
Query: 106 gccatttcagacgctagatctgagcaagagtgacactcggtgactggccttttgtagtcg 165
||||| |||| || ||||| ||||| ||||| |||||| |||| ||||| ||||||||
Sbjct: 573 gccatctcagcggcaagatccgagcaggagtggcactcgatgacaggcctcttgtagtca 514
Query: 166 atgtcctctggtctcatccagcagtaatggtcattaggctgactgctgcctttagaggtg 225
|||||||||||||||||||||||||| |||||||| ||| || |||||||||||||
Sbjct: 513 atgtcctctggtctcatccagcagtagtggtcattcggc---atggggcctttagaggtg 457
Query: 226 tcacctacacccacctgagcgacaatcctgtctatcgtgtcagcagatgaattgaaggtt 285
||||| || || ||||| ||||| |||| ||| || ||||| || || || || |||||
Sbjct: 456 tcacccacgccgacctgggcgacgatccggtcgatggtgtcggcggacgagttaaaggtc 397
Query: 286 ttgaggatgtagtctgttccccacttgatcagctccttgatatggtcgagctcaccgatg 345
||||| |||||||| || ||||||||||| | |||||||| |||||||||||| ||||||
Sbjct: 396 ttgagcatgtagtcggtgccccacttgatgatctccttgacatggtcgagctcgccgatg 337
Query: 346 gcctcgtac 354
|||||||||
Sbjct: 336 gcctcgtac 328
>gb|AV914894.1|AV914894 AV914894 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags8o19 5', mRNA sequence
Length = 562
Score = 212 bits (107), Expect = 6e-054
Identities = 278/333 (83%), Gaps = 4/333 (1%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 507 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 448
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 447 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 388
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 387 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 328
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 327 gc---atggggcctttagaggtgtcacccacgccgacctgggcgacgatccggtcgatgg 271
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagct-cc 321
|||| || || || || ||||| ||||| |||||||| || ||||||||||| | || ||
Sbjct: 270 tgtcggcggacgagttaaaggtcttgagcatgtagtcggtgccccacttgatgatctncc 211
Query: 322 ttgatatggtcgagctcaccgatggcctcgtac 354
|||| |||||||||||| |||||||||||||||
Sbjct: 210 ttgacatggtcgagctcgccgatggcctcgtac 178
>gb|AV914917.1|AV914917 AV914917 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9a10 5', mRNA sequence
Length = 618
Score = 212 bits (107), Expect = 6e-054
Identities = 278/333 (83%), Gaps = 4/333 (1%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 381 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 322
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 321 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 262
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcattag 202
|| |||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 261 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcattcg 202
Query: 203 gctgactgctgcctttagaggtgtcacctacacccacctgagcgacaatcctgtctatcg 262
|| || |||||||||||||||||| || || ||||| ||||| |||| ||| || |
Sbjct: 201 gc---atggggcctttagaggtgtcacccacgccgacctgggcgacgatccggtcgatgg 145
Query: 263 tgtcagcagatgaattgaaggttttgaggatgtagtctgttccccacttgatcagct-cc 321
|||| || || || || ||||| ||||| |||||||| || ||||||||||| | || ||
Sbjct: 144 tgtcggcggacgagttaaaggtcttgagcatgtagtcggtgccccacttgatgatctncc 85
Query: 322 ttgatatggtcgagctcaccgatggcctcgtac 354
|||| |||||||||||| |||||||||||||||
Sbjct: 84 ttgacatggtcgagctcgccgatggcctcgtac 52
>gb|AV925017.1|AV925017 AV925017 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd17o24 5', mRNA sequence
Length = 569
Score = 174 bits (88), Expect = 1e-042
Identities = 198/234 (84%), Gaps = 3/234 (1%)
Strand = Plus / Minus
Query: 121 agatctgagcaagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctc 180
||||| ||||| ||||| |||||| |||| ||||| |||||||| |||||||||||||||
Sbjct: 559 agatccgagcaggagtggcactcgatgacaggcctcttgtagtcaatgtcctctggtctc 500
Query: 181 atccagcagtaatggtcattaggctgactgctgcctttagaggtgtcacctacacccacc 240
||||||||||| |||||||| ||| || |||||||||||||||||| || || |||
Sbjct: 499 atccagcagtagtggtcattcggca---tggggcctttagaggtgtcacccacgccgacc 443
Query: 241 tgagcgacaatcctgtctatcgtgtcagcagatgaattgaaggttttgaggatgtagtct 300
|| ||||| |||| ||| || ||||| || || || || ||||| ||||| ||||||||
Sbjct: 442 tgggcgacgatccggtcgatggtgtcggcggacgagttaaaggtcttgagcatgtagtcg 383
Query: 301 gttccccacttgatcagctccttgatatggtcgagctcaccgatggcctcgtac 354
|| ||||||||||| | |||||||| |||||||||||| |||||||||||||||
Sbjct: 382 gtgccccacttgatgatctccttgacatggtcgagctcgccgatggcctcgtac 329
>gb|AV925025.1|AV925025 AV925025 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd17p12 5', mRNA sequence
Length = 566
Score = 174 bits (88), Expect = 1e-042
Identities = 198/234 (84%), Gaps = 3/234 (1%)
Strand = Plus / Minus
Query: 121 agatctgagcaagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctc 180
||||| ||||| ||||| |||||| |||| ||||| |||||||| |||||||||||||||
Sbjct: 555 agatccgagcaggagtggcactcgatgacaggcctcttgtagtcaatgtcctctggtctc 496
Query: 181 atccagcagtaatggtcattaggctgactgctgcctttagaggtgtcacctacacccacc 240
||||||||||| |||||||| ||| || |||||||||||||||||| || || |||
Sbjct: 495 atccagcagtagtggtcattcggca---tggggcctttagaggtgtcacccacgccgacc 439
Query: 241 tgagcgacaatcctgtctatcgtgtcagcagatgaattgaaggttttgaggatgtagtct 300
|| ||||| |||| ||| || ||||| || || || || ||||| ||||| ||||||||
Sbjct: 438 tgggcgacgatccggtcgatggtgtcggcggacgagttaaaggtcttgagcatgtagtcg 379
Query: 301 gttccccacttgatcagctccttgatatggtcgagctcaccgatggcctcgtac 354
|| ||||||||||| | |||||||| |||||||||||| |||||||||||||||
Sbjct: 378 gtgccccacttgatgatctccttgacatggtcgagctcgccgatggcctcgtac 325
>gb|BU983204.1|BU983204 HA28O05r HA Hordeum vulgare subsp. vulgare cDNA clone HA28O05
5-PRIME, mRNA sequence
Length = 456
Score = 165 bits (83), Expect = 1e-039
Identities = 193/229 (84%), Gaps = 3/229 (1%)
Strand = Plus / Minus
Query: 121 agatctgagcaagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctc 180
||||| ||||| ||||| |||||| |||| ||||| |||||||| |||||||||||||||
Sbjct: 456 agatccgagcaggagtggcactcgatgacaggcctcttgtagtcaatgtcctctggtctc 397
Query: 181 atccagcagtaatggtcattaggctgactgctgcctttagaggtgtcacctacacccacc 240
||||||||||| |||||||| ||| || |||||||||||||||||| || || |||
Sbjct: 396 atccagcagtagtggtcattcggca---tggggcctttagaggtgtcacccacgccgacc 340
Query: 241 tgagcgacaatcctgtctatcgtgtcagcagatgaattgaaggttttgaggatgtagtct 300
|| ||||| |||| ||| || ||||| || || || || ||||| ||||| ||||||||
Sbjct: 339 tgggcgacgatccggtcgatggtgtcggcggacgagttaaaggtcttgagcatgtagtcg 280
Query: 301 gttccccacttgatcagctccttgatatggtcgagctcaccgatggcct 349
|| ||||||||||| | |||||||| |||||||||||| ||||||||||
Sbjct: 279 gtgccccacttgatgatctccttgacatggtcgagctcgccgatggcct 231
>gb|BG365744.1|BG365744 HVSMEi0004A10f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0004A10f, mRNA sequence
Length = 484
Score = 147 bits (74), Expect = 3e-034
Identities = 152/178 (85%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 225 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 166
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 165 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 106
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcatt 200
|| |||| ||||| |||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 105 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcatt 48
>gb|AW982666.3|AW982666 HVSMEg0003O04f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0003O04f, mRNA sequence
Length = 898
Score = 147 bits (74), Expect = 3e-034
Identities = 152/178 (85%)
Strand = Plus / Minus
Query: 23 acagggccttggcgcccttgacgagcttgtcggagtaggttttgctgtccttgaacacta 82
|||| |||||||| || | ||| |||||||| ||||| | |||||||||||||||||||
Sbjct: 199 acagcgccttggcaccgtggacaagcttgtcagagtacgccttgctgtccttgaacacta 140
Query: 83 tggaagctgcagccagggcagcagccatttcagacgctagatctgagcaagagtgacact 142
||||||| || || ||||| || ||||| |||| || ||||| ||||| ||||| ||||
Sbjct: 139 tggaagccgcggcgagggcggcggccatctcagcggcaagatccgagcaggagtggcact 80
Query: 143 cggtgactggccttttgtagtcgatgtcctctggtctcatccagcagtaatggtcatt 200
|| |||| ||||| |||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 79 cgatgacaggcctcttgtagtcaatgtcctctggtctcatccagcagtagtggtcatt 22
>gb|BI776580.2|BI776580 EBpi07_SQ001_A20_R pistil, 12 DPA, no treatment, cv Optic, EBpi07
Hordeum vulgare subsp. vulgare cDNA clone
EBpi07_SQ001_A20 5', mRNA sequence
Length = 292
Score = 81.8 bits (41), Expect = 1e-014
Identities = 113/137 (82%)
Strand = Plus / Minus
Query: 70 tccttgaacactatggaagctgcagccagggcagcagccatttcagacgctagatctgag 129
||||||||||| ||||| ||||| |||| || |||||||| |||| | ||||| | |
Sbjct: 139 tccttgaacacaatggatgctgcggccaatgctgcagccatctcagcaccaagatcaggg 80
Query: 130 caagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctcatccagcag 189
|||| ||| |||||||||||||| | | |||||||||||||||||| |||||||| ||
Sbjct: 79 caagtgtggcactcggtgactggacgtgggtagtcgatgtcctctggcctcatccaacaa 20
Query: 190 taatggtcattaggctg 206
||||| ||||| |||||
Sbjct: 19 taatgatcattgggctg 3
>gb|CA027952.1|CA027952 HZ60I16r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ60I16
5-PRIME, mRNA sequence
Length = 448
Score = 73.8 bits (37), Expect = 4e-012
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 129 gcaagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctcatccagca 188
||||| ||| |||||||||||||| | | |||||||||||||||||| |||||||| ||
Sbjct: 419 gcaagtgtggcactcggtgactggacgtgggtagtcgatgtcctctggcctcatccaaca 360
Query: 189 gtaatggtcattaggctgact 209
||||| ||||| ||||||||
Sbjct: 359 ataatgatcattgggctgact 339
>gb|CA030964.1|CA030964 HX08K06r HX Hordeum vulgare subsp. vulgare cDNA clone HX08K06
5-PRIME, mRNA sequence
Length = 654
Score = 73.8 bits (37), Expect = 4e-012
Identities = 70/81 (86%)
Strand = Plus / Minus
Query: 129 gcaagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctcatccagca 188
||||| ||| |||||||||||||| | | |||||||||||||||||| |||||||| ||
Sbjct: 628 gcaagtgtggcactcggtgactggacgtgggtagtcgatgtcctctggcctcatccaaca 569
Query: 189 gtaatggtcattaggctgact 209
||||| ||||| ||||||||
Sbjct: 568 ataatgatcattgggctgact 548
>gb|BI949643.1|BI949643 HVSMEl0015A22f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0015A22f, mRNA sequence
Length = 902
Score = 71.9 bits (36), Expect = 1e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 70 tccttgaacactatggaagctgcagccagggcagcagccatttcagacgctagatctgag 129
||||||||||| ||||| ||||| |||| || |||||||| |||| | ||||| | |
Sbjct: 118 tccttgaacacaatggatgctgcggccaatgctgcagccatctcagcaccaagatcaggg 59
Query: 130 caagagtgacactcggtgactggccttttgtagtcgatgtcctctggtctcatcca 185
|||| ||| |||||||||||||| | | |||||||||||||||||| ||||||||
Sbjct: 58 caagtgtggcactcggtgactggacgtgggtagtcgatgtcctctggcctcatcca 3
>gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F09 5', mRNA sequence
Length = 387
Score = 52.0 bits (26), Expect = 1e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 348 ctcgtacctcggccgcgaccacgcta 373
||||||||||||||||||||||||||
Sbjct: 104 ctcgtacctcggccgcgaccacgcta 79
>gb|BM371350.1|BM371350 EBma08_SQ002_G09_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_G09 5', mRNA sequence
Length = 392
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 313 gtacctcggccgcgaccacgcta 335
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 78 ttcgagcggccgcccgggcagg 99
>gb|BM371364.1|BM371364 EBma08_SQ002_H03_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_H03 5', mRNA sequence
Length = 392
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 313 gtacctcggccgcgaccacgcta 335
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 78 ttcgagcggccgcccgggcagg 99
>gb|BM371365.1|BM371365 EBma08_SQ002_H04_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_H04 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM371395.1|BM371395 EBma08_SQ002_J02_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_J02 5', mRNA sequence
Length = 392
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 313 gtacctcggccgcgaccacgcta 335
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 78 ttcgagcggccgcccgggcagg 99
>gb|BM371412.1|BM371412 EBma08_SQ002_K03_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_K03 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM371462.1|BM371462 EBma08_SQ002_N04_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_N04 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM376006.1|BM376006 EBma01_SQ002_B01_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_B01 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM376095.1|BM376095 EBma01_SQ002_F10_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F10 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM376112.1|BM376112 EBma01_SQ002_G07_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_G07 5', mRNA sequence
Length = 392
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 313 gtacctcggccgcgaccacgcta 335
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 78 ttcgagcggccgcccgggcagg 99
>gb|BQ134680.1|BQ134680 LP30153 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-153
similar to Hexaprenyldihydroxybenzoate
methyltransferase,(S)-scoulerine 9-O-methyltransferase,
mRNA sequence
Length = 255
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 180 gtacctcggccgcgaccacgcta 202
>gb|BM376096.2|BM376096 EBma01_SQ002_F11_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F11 5', mRNA sequence
Length = 399
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 348 gtacctcggccgcgaccacgcta 370
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 113 ttcgagcggccgcccgggcagg 134
>gb|BM376175.2|BM376175 EBma01_SQ002_J04_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_J04 5', mRNA sequence
Length = 393
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
>gb|BM376199.2|BM376199 EBma01_SQ002_K09_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_K09 5', mRNA sequence
Length = 396
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 348 gtacctcggccgcgaccacgcta 370
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 113 ttcgagcggccgcccgggcagg 134
>gb|BM376260.2|BM376260 EBma01_SQ002_N09_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_N09 5', mRNA sequence
Length = 392
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 313 gtacctcggccgcgaccacgcta 335
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 78 ttcgagcggccgcccgggcagg 99
>gb|BM376261.2|BM376261 EBma01_SQ002_N10_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_N10 5', mRNA sequence
Length = 406
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 348 gtacctcggccgcgaccacgcta 370
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 113 ttcgagcggccgcccgggcagg 134
>gb|BM376262.2|BM376262 EBma01_SQ002_N11_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_N11 5', mRNA sequence
Length = 375
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 314 gtacctcggccgcgaccacgcta 336
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I05 5', mRNA sequence
Length = 581
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 101 gtacctcggccgcgaccacgcta 79
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 524 ttcgagcggccgcccgggcagg 503
>gb|BM371428.2|BM371428 EBma08_SQ002_L03_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_L03 5', mRNA sequence
Length = 413
Score = 46.1 bits (23), Expect = 8e-004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 351 gtacctcggccgcgaccacgcta 373
|||||||||||||||||||||||
Sbjct: 334 gtacctcggccgcgaccacgcta 356
>gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_H07 5', mRNA sequence
Length = 422
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 365 ttcgagcggccgcccgggcagg 344
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 99 acctcggccgcgaccacgcta 79
>gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA library from elongation stage
of kernel Hordeum vulgare subsp. vulgare cDNA clone
1-7, mRNA sequence
Length = 420
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 5 ttcgagcggccgcccgggcagg 26
>gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA library from gelatinous stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 2-59
similar to Rubisco small sub-unit gene, mRNA sequence
Length = 491
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 265 ttcgagcggccgcccgggcagg 244
>gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-159
similar to putative ABC transporter, mRNA sequence
Length = 339
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 286 ttcgagcggccgcccgggcagg 265
>gb|BQ294526.1|BQ294526 LP10283 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-283,
mRNA sequence
Length = 294
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 242 ttcgagcggccgcccgggcagg 221
>gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F01 5', mRNA sequence
Length = 256
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I06 5', mRNA sequence
Length = 494
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 438 ttcgagcggccgcccgggcagg 417
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 99 acctcggccgcgaccacgcta 79
>gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_L04 5', mRNA sequence
Length = 454
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BQ758127.1|BQ758127 EBma01_SQ002_L08_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_L08 5', mRNA sequence
Length = 202
Score = 44.1 bits (22), Expect = 0.003
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ttcgagcggccgcccgggcagg 22
||||||||||||||||||||||
Sbjct: 79 ttcgagcggccgcccgggcagg 100
>gb|BM371400.1|BM371400 EBma08_SQ002_J07_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_J07 5', mRNA sequence
Length = 379
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 302 acctcggccgcgaccacgcta 322
>gb|BM371413.1|BM371413 EBma08_SQ002_K05_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_K05 5', mRNA sequence
Length = 379
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 302 acctcggccgcgaccacgcta 322
>gb|BQ134691.1|BQ134691 LP30188 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-188
similar to Germin, mRNA sequence
Length = 557
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 482 acctcggccgcgaccacgcta 502
>gb|BQ134696.1|BQ134696 LP20015 Lemma/palea-enriched cDNA library from gelatinous stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 2-15
similar to S-adenosylmethionine decarboxylase, mRNA
sequence
Length = 430
Score = 42.1 bits (21), Expect = 0.013
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 353 acctcggccgcgaccacgcta 373
|||||||||||||||||||||
Sbjct: 406 acctcggccgcgaccacgcta 426
>gb|BQ135350.1|BQ135350 LP10104 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-104
similar to Arabidopsis putative tyrosyl-tRNA synthetase,
Accession No. AY075664, mRNA sequence
Length = 427
Score = 42.1 bits (21), Expect = 0.013
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 349 tcgtacctcggccgcgaccacgcta 373
|||| ||||||||||||||||||||
Sbjct: 351 tcgtgcctcggccgcgaccacgcta 375
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 39,945
Number of Sequences: 312970
Number of extensions: 39945
Number of successful extensions: 13024
Number of sequences better than 0.5: 57
Number of HSP's better than 0.5 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12929
Number of HSP's gapped (non-prelim): 93
length of query: 373
length of database: 175,134,539
effective HSP length: 18
effective length of query: 355
effective length of database: 169,501,079
effective search space: 60172883045
effective search space used: 60172883045
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)