BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3742446.2.1
(598 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU976210.1|BU976210 HA03F10r HA Hordeum vulgare subsp. v... 285 8e-076
gb|BU970797.1|BU970797 HB15L12r BC Hordeum vulgare subsp. v... 208 2e-052
gb|BE601754.2|BE601754 HVSMEh0099G19f Hordeum vulgare 5-45 ... 180 3e-044
gb|BI948619.1|BI948619 HVSMEl0010E10f Hordeum vulgare spike... 147 5e-034
gb|BQ464272.1|BQ464272 HF01M24T HF Hordeum vulgare subsp. v... 147 5e-034
gb|BJ462547.1|BJ462547 BJ462547 K. Sato unpublished cDNA li... 143 8e-033
gb|BG367505.2|BG367505 HVSMEi0012I04f Hordeum vulgare 20 DA... 137 5e-031
gb|BU986160.1|BU986160 HF09N16r HF Hordeum vulgare subsp. v... 135 2e-030
gb|BU986567.1|BU986567 HF12E04r HF Hordeum vulgare subsp. v... 135 2e-030
gb|BM441924.2|BM441924 EBed07_SQ001_O24_R endosperm, 28 DPA... 113 7e-024
gb|BG368358.1|BG368358 HVSMEi0017P04f Hordeum vulgare 20 DA... 86 2e-015
gb|BQ755335.1|BQ755335 EBed07_SQ002_G10_R endosperm, 28 DPA... 60 9e-008
gb|BQ755347.1|BQ755347 EBed07_SQ002_J07_R endosperm, 28 DPA... 60 9e-008
gb|BQ758950.1|BQ758950 EBma07_SQ003_G09_R maternal, 21 DPA,... 60 9e-008
gb|BU986792.1|BU986792 HF12O16r HF Hordeum vulgare subsp. v... 60 9e-008
gb|BJ467618.1|BJ467618 BJ467618 K. Sato unpublished cDNA li... 52 2e-005
gb|BQ468641.1|BQ468641 HM01N16T HM Hordeum vulgare subsp. v... 50 8e-005
gb|BU984559.1|BU984559 HF04E16r HF Hordeum vulgare subsp. v... 50 8e-005
gb|BF620598.2|BF620598 HVSMEc0020F14f Hordeum vulgare seedl... 40 0.081
>gb|BU976210.1|BU976210 HA03F10r HA Hordeum vulgare subsp. vulgare cDNA clone HA03F10
5-PRIME, mRNA sequence
Length = 571
Score = 285 bits (144), Expect = 8e-076
Identities = 373/448 (83%), Gaps = 1/448 (0%)
Strand = Plus / Plus
Query: 13 caaatctctaccattatgacctcccattggcactccatgaacag-acctgggctggctta 71
|||| |||||||| ||||||||||| |||| ||||| | ||| |||| |||||||| |
Sbjct: 27 caaacctctaccactatgacctcccgctggcgctccaccagcagtacctaggctggctaa 86
Query: 72 gcccaaagattgtggaggcgtttgcagactacgccgagttctgcttccacgcgttcggag 131
|||||||||| |||| || ||||| ||||| ||||||||||||||| | | |||||| |
Sbjct: 87 gcccaaagatcgtgggcgcatttgcggactatgccgagttctgcttcaaggtgttcgggg 146
Query: 132 acagggtgaagaactggtttaccttcaacgagccgaggtgcgtcgctgctctgggctacg 191
||||||||||||||||||| |||||||||||||| ||| |||||| |||||||| ||||
Sbjct: 147 acagggtgaagaactggttcaccttcaacgagccaagggtcgtcgccgctctggggtacg 206
Query: 192 acaatggcttgcacgcaccgggaaggtgttccgggtgccccgccggaggcaactccacca 251
|||||||||| || || || || ||||| ||| |||||| || |||||| |||||| |
Sbjct: 207 acaatggcttccatgcgcctgggaggtgctccaagtgccctgcaggaggcgactccagga 266
Query: 252 cggaaccgtaccttgtcgcacaccatctcatcctttctcatgcagctgcggccaggcgat 311
|||| |||||| ||||| | ||| || |||||||||| ||||| || |||| ||||
Sbjct: 267 cggagccgtacattgtcacgcacaatatcatcctttcgcatgccgcagcggtgcaacgat 326
Query: 312 accgcgacaagtatcagcttcaccagaaggggaagattggaattctcctggatttcgtgt 371
|||| || |||||||||| ||||||||||||| |||||| |||||| ||||||||||||
Sbjct: 327 accgggagaagtatcagccacaccagaaggggaggattgggattctcttggatttcgtgt 386
Query: 372 ggtacgaacctttcagcgacagcaatgcggaccaggctgcagcacagcgagccagggact 431
||||||||||| ||||||||||||||| || || ||||| || ||| | || |||||||
Sbjct: 387 ggtacgaacctcacagcgacagcaatgccgatcaagctgccgcgcagagggcgagggact 446
Query: 432 tccacctaggctggttccttgaccccat 459
||||| | || |||||||| ||||||||
Sbjct: 447 tccacattggatggttcctcgaccccat 474
>gb|BU970797.1|BU970797 HB15L12r BC Hordeum vulgare subsp. vulgare cDNA clone HB15L12
5-PRIME, mRNA sequence
Length = 587
Score = 208 bits (105), Expect = 2e-052
Identities = 267/321 (83%)
Strand = Plus / Plus
Query: 139 gaagaactggtttaccttcaacgagccgaggtgcgtcgctgctctgggctacgacaatgg 198
|||||||||||| |||||||||||||| ||| |||||| |||||||| |||||||||||
Sbjct: 11 gaagaactggttcaccttcaacgagccaagggtcgtcgccgctctggggtacgacaatgg 70
Query: 199 cttgcacgcaccgggaaggtgttccgggtgccccgccggaggcaactccaccacggaacc 258
||| || || || || ||||| ||| |||||| || |||||| |||||| ||||| ||
Sbjct: 71 cttccatgcgcctgggaggtgctccaagtgccctgcaggaggcgactccaggacggagcc 130
Query: 259 gtaccttgtcgcacaccatctcatcctttctcatgcagctgcggccaggcgataccgcga 318
|||| ||||| | ||| || |||||||||| ||||| || |||| |||||||| ||
Sbjct: 131 gtacattgtcacgcacaatatcatcctttcgcatgccgcagcggtgcaacgataccggga 190
Query: 319 caagtatcagcttcaccagaaggggaagattggaattctcctggatttcgtgtggtacga 378
|||||||||| ||||||||||||| |||||| |||||| |||||||||||||||||||
Sbjct: 191 gaagtatcagccacaccagaaggggaggattgggattctcttggatttcgtgtggtacga 250
Query: 379 acctttcagcgacagcaatgcggaccaggctgcagcacagcgagccagggacttccacct 438
|||| ||||||||||||||| || || ||||| || ||| | || |||||||||||| |
Sbjct: 251 acctcacagcgacagcaatgccgatcaagctgccgcgcagagggcgagggacttccacat 310
Query: 439 aggctggttccttgaccccat 459
|| |||||||| ||||||||
Sbjct: 311 tggatggttcctcgaccccat 331
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 406 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 459
>gb|BE601754.2|BE601754 HVSMEh0099G19f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0099G19f, mRNA sequence
Length = 505
Score = 180 bits (91), Expect = 3e-044
Identities = 236/283 (83%), Gaps = 1/283 (0%)
Strand = Plus / Plus
Query: 13 caaatctctaccattatgacctcccattggcactccatgaacag-acctgggctggctta 71
|||| |||||||| ||||||||||| |||| ||||| | ||| |||| |||||||| |
Sbjct: 165 caaacctctaccactatgacctcccgctggcgctccaccagcagtacctaggctggctaa 224
Query: 72 gcccaaagattgtggaggcgtttgcagactacgccgagttctgcttccacgcgttcggag 131
|||||||||| |||| || ||||| ||||| ||||||||||||||| | | |||||| |
Sbjct: 225 gcccaaagatcgtgggcgcatttgcggactatgccgagttctgcttcaaggtgttcgggg 284
Query: 132 acagggtgaagaactggtttaccttcaacgagccgaggtgcgtcgctgctctgggctacg 191
||||||||||||||||||| |||||||||||||| ||| |||||| |||||||| ||||
Sbjct: 285 acagggtgaagaactggttcaccttcaacgagccaagggtcgtcgccgctctggggtacg 344
Query: 192 acaatggcttgcacgcaccgggaaggtgttccgggtgccccgccggaggcaactccacca 251
|||||||||| || || || || ||||| ||| |||||| || |||||| |||||| |
Sbjct: 345 acaatggcttccatgcgcctgggaggtgctccaagtgccctgcaggaggcgactccagga 404
Query: 252 cggaaccgtaccttgtcgcacaccatctcatcctttctcatgc 294
|||| |||||| ||||| | ||| || |||||||||| |||||
Sbjct: 405 cggagccgtacattgtcacgcacaatatcatcctttcgcatgc 447
>gb|BI948619.1|BI948619 HVSMEl0010E10f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0010E10f, mRNA sequence
Length = 1046
Score = 147 bits (74), Expect = 5e-034
Identities = 194/234 (82%)
Strand = Plus / Plus
Query: 226 gtgccccgccggaggcaactccaccacggaaccgtaccttgtcgcacaccatctcatcct 285
|||||| || |||||| |||||| ||||| |||||| ||||| | ||| || |||||||
Sbjct: 6 gtgccctgcaggaggcgactccaggacggagccgtacattgtcacgcacaatatcatcct 65
Query: 286 ttctcatgcagctgcggccaggcgataccgcgacaagtatcagcttcaccagaaggggaa 345
||| ||||| || |||| |||||||| || |||||||||| |||||||||||||
Sbjct: 66 ttcgcatgccgcagcggtgcaacgataccgggagaagtatcagccacaccagaaggggag 125
Query: 346 gattggaattctcctggatttcgtgtggtacgaacctttcagcgacagcaatgcggacca 405
|||||| |||||| ||||||||||||||||||||||| ||||||||||||||| || ||
Sbjct: 126 gattgggattctcttggatttcgtgtggtacgaacctcacagcgacagcaatgccgatca 185
Query: 406 ggctgcagcacagcgagccagggacttccacctaggctggttccttgaccccat 459
||||| || ||| | || |||||||||||| | || |||||||| ||||||||
Sbjct: 186 agctgccgcgcagagggcgagggacttccacattggatggttcctcgaccccat 239
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 314 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 367
>gb|BQ464272.1|BQ464272 HF01M24T HF Hordeum vulgare subsp. vulgare cDNA clone HF01M24
5-PRIME, mRNA sequence
Length = 678
Score = 147 bits (74), Expect = 5e-034
Identities = 194/234 (82%)
Strand = Plus / Plus
Query: 226 gtgccccgccggaggcaactccaccacggaaccgtaccttgtcgcacaccatctcatcct 285
|||||| || |||||| |||||| ||||| |||||| ||||| | ||| || |||||||
Sbjct: 18 gtgccctgcaggaggcgactccaggacggagccgtacattgtcacgcacaatatcatcct 77
Query: 286 ttctcatgcagctgcggccaggcgataccgcgacaagtatcagcttcaccagaaggggaa 345
||| ||||| || |||| |||||||| || |||||||||| |||||||||||||
Sbjct: 78 ttcgcatgccgcagcggtgcaacgataccgggagaagtatcagccacaccagaaggggag 137
Query: 346 gattggaattctcctggatttcgtgtggtacgaacctttcagcgacagcaatgcggacca 405
|||||| |||||| ||||||||||||||||||||||| ||||||||||||||| || ||
Sbjct: 138 gattgggattctcttggatttcgtgtggtacgaacctcacagcgacagcaatgccgatca 197
Query: 406 ggctgcagcacagcgagccagggacttccacctaggctggttccttgaccccat 459
||||| || ||| | || |||||||||||| | || |||||||| ||||||||
Sbjct: 198 agctgccgcgcagagggcgagggacttccacattggatggttcctcgaccccat 251
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 326 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 379
>gb|BJ462547.1|BJ462547 BJ462547 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags29b06 5', mRNA sequence
Length = 657
Score = 143 bits (72), Expect = 8e-033
Identities = 147/172 (85%)
Strand = Plus / Plus
Query: 306 ggcgataccgcgacaagtatcagcttcaccagaaggggaagattggaattctcctggatt 365
||||||||||||| |||||||||| |||||| ||||||| ||||||||||||| ||||||
Sbjct: 17 ggcgataccgcgagaagtatcagcctcaccaaaaggggaggattggaattctcttggatt 76
Query: 366 tcgtgtggtacgaacctttcagcgacagcaatgcggaccaggctgcagcacagcgagcca 425
| || |||||||| || || ||| ||| |||||| || || |||||||||||| | || |
Sbjct: 77 ttgtatggtacgagccattgagcaacaacaatgctgatcaagctgcagcacagagggcaa 136
Query: 426 gggacttccacctaggctggttccttgaccccattgtacatggacggtaccc 477
|||| |||||||| || ||||||||||||||||| ||||||| || |||||
Sbjct: 137 gggatttccaccttggatggttccttgaccccatcatacatggtcgctaccc 188
Score = 52.0 bits (26), Expect = 2e-005
Identities = 39/42 (92%), Gaps = 1/42 (2%)
Strand = Plus / Plus
Query: 557 gactatgttggcatcaaccactacacttcttttctacatgaa 598
||||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 268 gactatgttggtatcaaccaatacacttc-tttctacatgaa 308
>gb|BG367505.2|BG367505 HVSMEi0012I04f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0012I04f, mRNA sequence
Length = 692
Score = 137 bits (69), Expect = 5e-031
Identities = 174/209 (83%)
Strand = Plus / Plus
Query: 251 acggaaccgtaccttgtcgcacaccatctcatcctttctcatgcagctgcggccaggcga 310
||||| |||||| ||||| | ||| || |||||||||| ||||| || |||| |||
Sbjct: 5 acggagccgtacattgtcacgcacaatatcatcctttcgcatgccgcagcggtgcaacga 64
Query: 311 taccgcgacaagtatcagcttcaccagaaggggaagattggaattctcctggatttcgtg 370
||||| || |||||||||| ||||||||||||| |||||| |||||| |||||||||||
Sbjct: 65 taccgggagaagtatcagccacaccagaaggggaggattgggattctcttggatttcgtg 124
Query: 371 tggtacgaacctttcagcgacagcaatgcggaccaggctgcagcacagcgagccagggac 430
|||||||||||| ||||||||||||||| || || ||||| || ||| | || ||||||
Sbjct: 125 tggtacgaacctcacagcgacagcaatgccgatcaagctgccgcgcagagggcgagggac 184
Query: 431 ttccacctaggctggttccttgaccccat 459
|||||| | || |||||||| ||||||||
Sbjct: 185 ttccacattggatggttcctcgaccccat 213
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 288 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 341
>gb|BU986160.1|BU986160 HF09N16r HF Hordeum vulgare subsp. vulgare cDNA clone HF09N16
5-PRIME, mRNA sequence
Length = 587
Score = 135 bits (68), Expect = 2e-030
Identities = 131/152 (86%)
Strand = Plus / Plus
Query: 308 cgataccgcgacaagtatcagcttcaccagaaggggaagattggaattctcctggatttc 367
|||||||| || |||||||||| ||||||||||||| |||||| |||||| ||||||||
Sbjct: 10 cgataccgggagaagtatcagccacaccagaaggggaggattgggattctcttggatttc 69
Query: 368 gtgtggtacgaacctttcagcgacagcaatgcggaccaggctgcagcacagcgagccagg 427
||||||||||||||| ||||||||||||||| || || ||||| || ||| | || |||
Sbjct: 70 gtgtggtacgaacctcacagcgacagcaatgccgatcaagctgccgcgcagagggcgagg 129
Query: 428 gacttccacctaggctggttccttgaccccat 459
||||||||| | || |||||||| ||||||||
Sbjct: 130 gacttccacattggatggttcctcgaccccat 161
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 236 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 289
>gb|BU986567.1|BU986567 HF12E04r HF Hordeum vulgare subsp. vulgare cDNA clone HF12E04
5-PRIME, mRNA sequence
Length = 570
Score = 135 bits (68), Expect = 2e-030
Identities = 131/152 (86%)
Strand = Plus / Plus
Query: 308 cgataccgcgacaagtatcagcttcaccagaaggggaagattggaattctcctggatttc 367
|||||||| || |||||||||| ||||||||||||| |||||| |||||| ||||||||
Sbjct: 52 cgataccgggagaagtatcagccacaccagaaggggaggattgggattctcttggatttc 111
Query: 368 gtgtggtacgaacctttcagcgacagcaatgcggaccaggctgcagcacagcgagccagg 427
||||||||||||||| ||||||||||||||| || || ||||| || ||| | || |||
Sbjct: 112 gtgtggtacgaacctcacagcgacagcaatgccgatcaagctgccgcgcagagggcgagg 171
Query: 428 gacttccacctaggctggttccttgaccccat 459
||||||||| | || |||||||| ||||||||
Sbjct: 172 gacttccacattggatggttcctcgaccccat 203
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 278 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 331
>gb|BM441924.2|BM441924 EBed07_SQ001_O24_R endosperm, 28 DPA, no treatment, cv Optic,
EBed07 Hordeum vulgare subsp. vulgare cDNA clone
EBed07_SQ001_O24 5', mRNA sequence
Length = 387
Score = 113 bits (57), Expect = 7e-024
Identities = 108/125 (86%)
Strand = Plus / Plus
Query: 335 cagaaggggaagattggaattctcctggatttcgtgtggtacgaacctttcagcgacagc 394
|||||||||| |||||| |||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 1 cagaaggggaggattgggattctcttggatttcgtgtggtacgaacctcacagcgacagc 60
Query: 395 aatgcggaccaggctgcagcacagcgagccagggacttccacctaggctggttccttgac 454
||||| || || ||||| || ||| | || |||||||||||| | || |||||||| |||
Sbjct: 61 aatgccgatcaagctgccgcgcagagggcgagggacttccacattggatggttcctcgac 120
Query: 455 cccat 459
|||||
Sbjct: 121 cccat 125
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 200 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 253
>gb|BG368358.1|BG368358 HVSMEi0017P04f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0017P04f, mRNA sequence
Length = 671
Score = 85.7 bits (43), Expect = 2e-015
Identities = 91/107 (85%)
Strand = Plus / Plus
Query: 353 attctcctggatttcgtgtggtacgaacctttcagcgacagcaatgcggaccaggctgca 412
|||||| ||||||||||||||||||||||| ||||||||||||||| || || |||||
Sbjct: 1 attctcttggatttcgtgtggtacgaacctcacagcgacagcaatgccgatcaagctgcc 60
Query: 413 gcacagcgagccagggacttccacctaggctggttccttgaccccat 459
|| ||| | || |||||||||||| | || |||||||| |||||||
Sbjct: 61 gcgcagagggcgagggacttccacattggatggttcctcaaccccat 107
Score = 58.0 bits (29), Expect = 3e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 539 atggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 187 atggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 235
>gb|BQ755335.1|BQ755335 EBed07_SQ002_G10_R endosperm, 28 DPA, no treatment, cv Optic,
EBed07 Hordeum vulgare subsp. vulgare cDNA clone
EBed07_SQ002_G10 5', mRNA sequence
Length = 449
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 97 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 150
>gb|BQ755347.1|BQ755347 EBed07_SQ002_J07_R endosperm, 28 DPA, no treatment, cv Optic,
EBed07 Hordeum vulgare subsp. vulgare cDNA clone
EBed07_SQ002_J07 5', mRNA sequence
Length = 642
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 22 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 75
>gb|BQ758950.1|BQ758950 EBma07_SQ003_G09_R maternal, 21 DPA, no treatment, cv Optic, EBma07
Hordeum vulgare subsp. vulgare cDNA clone
EBma07_SQ003_G09 5', mRNA sequence
Length = 350
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 154 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 207
Score = 54.0 bits (27), Expect = 5e-006
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 385 cagcgacagcaatgcggaccaggctgcagcacagcgagccagggacttccacctaggctg 444
||||||||||||||| || || ||||| || ||| | || |||||||||||| | || ||
Sbjct: 5 cagcgacagcaatgccgatcaagctgccgcgcagagggcgagggacttccacattggatg 64
Query: 445 gttccttgaccccat 459
|||||| ||||||||
Sbjct: 65 gttcctcgaccccat 79
>gb|BU986792.1|BU986792 HF12O16r HF Hordeum vulgare subsp. vulgare cDNA clone HF12O16
5-PRIME, mRNA sequence
Length = 615
Score = 60.0 bits (30), Expect = 9e-008
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 534 ccaggatggcgaaaggctctatagactatgttggcatcaaccactacacttctt 587
|||| |||| ||||||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 32 ccagaatggtgaaaggctccattgactatgttggtatcaaccagtacacttctt 85
>gb|BJ467618.1|BJ467618 BJ467618 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags29b06 3', mRNA sequence
Length = 709
Score = 52.0 bits (26), Expect = 2e-005
Identities = 39/42 (92%), Gaps = 1/42 (2%)
Strand = Plus / Minus
Query: 557 gactatgttggcatcaaccactacacttcttttctacatgaa 598
||||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 654 gactatgttggtatcaaccaatacacttc-tttctacatgaa 614
>gb|BQ468641.1|BQ468641 HM01N16T HM Hordeum vulgare subsp. vulgare cDNA clone HM01N16
5-PRIME, mRNA sequence
Length = 632
Score = 50.1 bits (25), Expect = 8e-005
Identities = 49/57 (85%)
Strand = Plus / Plus
Query: 110 ttctgcttccacgcgttcggagacagggtgaagaactggtttaccttcaacgagccg 166
||||||||| | ||| ||| ||| |||||||||||||||| ||| |||||||||||
Sbjct: 219 ttctgcttcaagacgtacggcgaccgggtgaagaactggttcaccatcaacgagccg 275
Score = 38.2 bits (19), Expect = 0.32
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 356 ctcctggatttcgtgtggtacga 378
|||||||| ||||||||||||||
Sbjct: 465 ctcctggacttcgtgtggtacga 487
>gb|BU984559.1|BU984559 HF04E16r HF Hordeum vulgare subsp. vulgare cDNA clone HF04E16
5-PRIME, mRNA sequence
Length = 590
Score = 50.1 bits (25), Expect = 8e-005
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 547 aggctctatagactatgttggcatcaaccactacacttctt 587
|||||| || ||||||||||| |||||||| ||||||||||
Sbjct: 1 aggctccattgactatgttggtatcaaccagtacacttctt 41
>gb|BF620598.2|BF620598 HVSMEc0020F14f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0020F14f, mRNA sequence
Length = 882
Score = 40.1 bits (20), Expect = 0.081
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 221 tccgggtgccccgccggagg 240
||||||||||||||||||||
Sbjct: 743 tccgggtgccccgccggagg 762
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 54,432
Number of Sequences: 312970
Number of extensions: 54432
Number of successful extensions: 16123
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16087
Number of HSP's gapped (non-prelim): 30
length of query: 598
length of database: 175,134,539
effective HSP length: 19
effective length of query: 579
effective length of database: 169,188,109
effective search space: 97959915111
effective search space used: 97959915111
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)