BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3696657.2.1
(1531 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BM442515.2|BM442515 EBan01_SQ003_G09_R anther, yellow st... 70 2e-010
gb|BM442620.2|BM442620 EBan01_SQ003_L02_R anther, yellow st... 68 9e-010
gb|BM442473.2|BM442473 EBan01_SQ003_E14_R anther, yellow st... 66 4e-009
gb|BQ753283.1|BQ753283 EBan01_SQ001_C11_R anther, yellow st... 66 4e-009
gb|BQ753595.1|BQ753595 EBan01_SQ004_L07_R anther, yellow st... 66 4e-009
gb|BQ764168.1|BQ764168 EBan01_SQ005_F02_R anther, yellow st... 66 4e-009
gb|CB881820.1|CB881820 HM10P12w HM Hordeum vulgare subsp. v... 48 9e-004
gb|BQ660177.1|BQ660177 HI01F04w HI Hordeum vulgare subsp. v... 46 0.003
gb|CB876272.1|CB876272 HX10M17w HX Hordeum vulgare subsp. v... 46 0.003
gb|BE455856.2|BE455856 HVSMEg0015N01f Hordeum vulgare pre-a... 44 0.014
gb|BQ470839.1|BQ470839 HX04D02r HX Hordeum vulgare subsp. v... 44 0.014
gb|CA030305.1|CA030305 HX06K19r HX Hordeum vulgare subsp. v... 44 0.014
gb|CB874906.1|CB874906 HX06K19w HX Hordeum vulgare subsp. v... 44 0.014
gb|BM442145.2|BM442145 EBan01_SQ002_F12_R anther, yellow st... 42 0.053
>gb|BM442515.2|BM442515 EBan01_SQ003_G09_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ003_G09 5', mRNA sequence
Length = 588
Score = 69.9 bits (35), Expect = 2e-010
Identities = 119/147 (80%)
Strand = Plus / Minus
Query: 604 ggactcggcgtccacgtacgacttgatgcgcacgccgttggtggtgttcttgagcacgca 663
||||| || |||| |||||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 155 ggacttggagtcctcgtacgacttgatgcggaggccgttggtggatcccttgaacacgca 96
Query: 664 gttccgcaccgtgatgtcgctcacgtccttctcgtccttgtagcggcctaggcagccgac 723
|||| || ||||||| |||||||||||||||||||||| | || |||| ||| |
Sbjct: 95 gttcttgacgtggatgtcggtcacgtccttctcgtccttgtacctcccgaggctgccaat 36
Query: 724 gctgatgccctgcccggggccgcaggt 750
|||||||| || || |||||||||||
Sbjct: 35 actgatgccgtggcctgggccgcaggt 9
Score = 65.9 bits (33), Expect = 4e-009
Identities = 63/73 (86%)
Strand = Plus / Minus
Query: 401 gagcagagcaggctgatggcctcgggcgtggacgacgtgccggtgatgttgcggaacgtg 460
|||||||||||||||| |||||| || ||||| || |||||||||||||| ||| ||
Sbjct: 355 gagcagagcaggctgacggcctcaggggtggaggaggtgccggtgatgtttttgaaggta 296
Query: 461 acgtccttgacgg 473
|||||||||||||
Sbjct: 295 acgtccttgacgg 283
Score = 58.0 bits (29), Expect = 9e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 294 tggcggtgcccttggcgttgctgcagacggccatggttttgttgttcttgccggcgtact 353
|||||||| | ||| ||||| | ||||| |||||||| |||||||||||||||| |||||
Sbjct: 462 tggcggtgactttgacgttggtacagacagccatggtcttgttgttcttgccggagtact 403
Query: 354 c 354
|
Sbjct: 402 c 402
>gb|BM442620.2|BM442620 EBan01_SQ003_L02_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ003_L02 5', mRNA sequence
Length = 377
Score = 67.9 bits (34), Expect = 9e-010
Identities = 85/102 (83%)
Strand = Plus / Minus
Query: 604 ggactcggcgtccacgtacgacttgatgcgcacgccgttggtggtgttcttgagcacgca 663
||||| || |||| |||||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 262 ggacttggagtcctcgtacgacttgatgcggaggccgttggtggatcccttgaacacgca 203
Query: 664 gttccgcaccgtgatgtcgctcacgtccttctcgtccttgta 705
|||| || ||||||| ||||||||||||||||||||||
Sbjct: 202 gttcttgacgtggatgtcggtcacgtccttctcgtccttgta 161
>gb|BM442473.2|BM442473 EBan01_SQ003_E14_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ003_E14 5', mRNA sequence
Length = 454
Score = 65.9 bits (33), Expect = 4e-009
Identities = 63/73 (86%)
Strand = Plus / Minus
Query: 401 gagcagagcaggctgatggcctcgggcgtggacgacgtgccggtgatgttgcggaacgtg 460
|||||||||||||||| |||||| || ||||| || |||||||||||||| ||| ||
Sbjct: 262 gagcagagcaggctgacggcctcaggggtggaggaggtgccggtgatgtttttgaaggta 203
Query: 461 acgtccttgacgg 473
|||||||||||||
Sbjct: 202 acgtccttgacgg 190
Score = 58.0 bits (29), Expect = 9e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 294 tggcggtgcccttggcgttgctgcagacggccatggttttgttgttcttgccggcgtact 353
|||||||| | ||| ||||| | ||||| |||||||| |||||||||||||||| |||||
Sbjct: 369 tggcggtgactttgacgttggtacagacagccatggtcttgttgttcttgccggagtact 310
Query: 354 c 354
|
Sbjct: 309 c 309
Score = 48.1 bits (24), Expect = 9e-004
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 604 ggactcggcgtccacgtacgacttgatgcgcacgccgttggtgg 647
||||| || |||| |||||||||||||||| | |||||||||||
Sbjct: 62 ggacttggagtcctcgtacgacttgatgcggaggccgttggtgg 19
>gb|BQ753283.1|BQ753283 EBan01_SQ001_C11_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ001_C11 5', mRNA sequence
Length = 647
Score = 65.9 bits (33), Expect = 4e-009
Identities = 63/73 (86%)
Strand = Plus / Minus
Query: 401 gagcagagcaggctgatggcctcgggcgtggacgacgtgccggtgatgttgcggaacgtg 460
|||||||||||||||| |||||| || ||||| || |||||||||||||| ||| ||
Sbjct: 158 gagcagagcaggctgacggcctcaggggtggaggaggtgccggtgatgtttttgaaggta 99
Query: 461 acgtccttgacgg 473
|||||||||||||
Sbjct: 98 acgtccttgacgg 86
Score = 58.0 bits (29), Expect = 9e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 294 tggcggtgcccttggcgttgctgcagacggccatggttttgttgttcttgccggcgtact 353
|||||||| | ||| ||||| | ||||| |||||||| |||||||||||||||| |||||
Sbjct: 265 tggcggtgactttgacgttggtacagacagccatggtcttgttgttcttgccggagtact 206
Query: 354 c 354
|
Sbjct: 205 c 205
>gb|BQ753595.1|BQ753595 EBan01_SQ004_L07_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ004_L07 5', mRNA sequence
Length = 436
Score = 65.9 bits (33), Expect = 4e-009
Identities = 63/73 (86%)
Strand = Plus / Minus
Query: 401 gagcagagcaggctgatggcctcgggcgtggacgacgtgccggtgatgttgcggaacgtg 460
|||||||||||||||| |||||| || ||||| || |||||||||||||| ||| ||
Sbjct: 237 gagcagagcaggctgacggcctcaggggtggaggaggtgccggtgatgtttttgaaggta 178
Query: 461 acgtccttgacgg 473
|||||||||||||
Sbjct: 177 acgtccttgacgg 165
Score = 58.0 bits (29), Expect = 9e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 294 tggcggtgcccttggcgttgctgcagacggccatggttttgttgttcttgccggcgtact 353
|||||||| | ||| ||||| | ||||| |||||||| |||||||||||||||| |||||
Sbjct: 344 tggcggtgactttgacgttggtacagacagccatggtcttgttgttcttgccggagtact 285
Query: 354 c 354
|
Sbjct: 284 c 284
>gb|BQ764168.1|BQ764168 EBan01_SQ005_F02_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ005_F02 5', mRNA sequence
Length = 693
Score = 65.9 bits (33), Expect = 4e-009
Identities = 63/73 (86%)
Strand = Plus / Minus
Query: 401 gagcagagcaggctgatggcctcgggcgtggacgacgtgccggtgatgttgcggaacgtg 460
|||||||||||||||| |||||| || ||||| || |||||||||||||| ||| ||
Sbjct: 297 gagcagagcaggctgacggcctcaggggtggaggaggtgccggtgatgtttttgaaggta 238
Query: 461 acgtccttgacgg 473
|||||||||||||
Sbjct: 237 acgtccttgacgg 225
Score = 58.0 bits (29), Expect = 9e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 294 tggcggtgcccttggcgttgctgcagacggccatggttttgttgttcttgccggcgtact 353
|||||||| | ||| ||||| | ||||| |||||||| |||||||||||||||| |||||
Sbjct: 404 tggcggtgactttgacgttggtacagacagccatggtcttgttgttcttgccggagtact 345
Query: 354 c 354
|
Sbjct: 344 c 344
Score = 58.0 bits (29), Expect = 9e-007
Identities = 80/97 (82%)
Strand = Plus / Minus
Query: 604 ggactcggcgtccacgtacgacttgatgcgcacgccgttggtggtgttcttgagcacgca 663
||||| || |||| |||||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 97 ggacttggagtcctcgtacgacttgatgcggaggccgttggtggatcccttgaacacgca 38
Query: 664 gttccgcaccgtgatgtcgctcacgtccttctcgtcc 700
|||| || ||||||| |||||||||||||||||
Sbjct: 37 gttcttgacgtggatgtcggtcacgtccttctcgtcc 1
>gb|CB881820.1|CB881820 HM10P12w HM Hordeum vulgare subsp. vulgare cDNA clone HM10P12
3-PRIME, mRNA sequence
Length = 608
Score = 48.1 bits (24), Expect = 9e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 794 acgcagtcgtcgccggtgccgatg 817
||||||||||||||||||||||||
Sbjct: 319 acgcagtcgtcgccggtgccgatg 296
>gb|BQ660177.1|BQ660177 HI01F04w HI Hordeum vulgare subsp. vulgare cDNA clone HI01F04
3-PRIME, mRNA sequence
Length = 618
Score = 46.1 bits (23), Expect = 0.003
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 529 ctggtcgatgacgatggggttggccac 555
||||||||||| |||||||||||||||
Sbjct: 479 ctggtcgatgatgatggggttggccac 505
>gb|CB876272.1|CB876272 HX10M17w HX Hordeum vulgare subsp. vulgare cDNA clone HX10M17
3-PRIME, mRNA sequence
Length = 638
Score = 46.1 bits (23), Expect = 0.003
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 529 ctggtcgatgacgatggggttggccac 555
||||||||||| |||||||||||||||
Sbjct: 478 ctggtcgatgatgatggggttggccac 504
>gb|BE455856.2|BE455856 HVSMEg0015N01f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0015N01f, mRNA sequence
Length = 576
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 526 gtactggtcgatgacgatggggttgg 551
|||||||||||||| |||||||||||
Sbjct: 190 gtactggtcgatgatgatggggttgg 165
>gb|BQ470839.1|BQ470839 HX04D02r HX Hordeum vulgare subsp. vulgare cDNA clone HX04D02
5-PRIME, mRNA sequence
Length = 650
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 526 gtactggtcgatgacgatggggttgg 551
|||||||||||||| |||||||||||
Sbjct: 514 gtactggtcgatgatgatggggttgg 489
>gb|CA030305.1|CA030305 HX06K19r HX Hordeum vulgare subsp. vulgare cDNA clone HX06K19
5-PRIME, mRNA sequence
Length = 546
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 526 gtactggtcgatgacgatggggttgg 551
|||||||||||||| |||||||||||
Sbjct: 297 gtactggtcgatgatgatggggttgg 272
>gb|CB874906.1|CB874906 HX06K19w HX Hordeum vulgare subsp. vulgare cDNA clone HX06K19
3-PRIME, mRNA sequence
Length = 592
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 526 gtactggtcgatgacgatggggttgg 551
|||||||||||||| |||||||||||
Sbjct: 407 gtactggtcgatgatgatggggttgg 432
>gb|BM442145.2|BM442145 EBan01_SQ002_F12_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ002_F12 5', mRNA sequence
Length = 311
Score = 42.1 bits (21), Expect = 0.053
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 934 gatgttgatgtggaagaacttggagttga 962
|||||| ||||||||||||||||| ||||
Sbjct: 188 gatgttcatgtggaagaacttggaattga 160
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 204,563
Number of Sequences: 312970
Number of extensions: 204563
Number of successful extensions: 61695
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61623
Number of HSP's gapped (non-prelim): 71
length of query: 1531
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1512
effective length of database: 169,188,109
effective search space: 255812420808
effective search space used: 255812420808
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)