BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115190.2.1
(656 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BM442096.2|BM442096 EBan01_SQ002_C23_R anther, yellow st... 60 1e-007
gb|BU981349.1|BU981349 HA23F03r HA Hordeum vulgare subsp. v... 42 0.023
gb|BU995294.1|BU995294 HM09M17r HM Hordeum vulgare subsp. v... 42 0.023
gb|CB881433.1|CB881433 HM09M17w HM Hordeum vulgare subsp. v... 42 0.023
>gb|BM442096.2|BM442096 EBan01_SQ002_C23_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ002_C23 5', mRNA sequence
Length = 356
Score = 60.0 bits (30), Expect = 1e-007
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 502 gaagatggcgccgttcatgaacaggtcgtcctccgtgtgccacacccagttcttccac 559
||||| |||| |||||| | ||||||||||| || ||||||||||||||||||||||
Sbjct: 307 gaagacggcgtcgttcagcagcaggtcgtcctgcgagtgccacacccagttcttccac 250
Score = 42.1 bits (21), Expect = 0.023
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 621 agcggttgccctggctgatgatggt 645
||||||| |||||||||||||||||
Sbjct: 185 agcggttcccctggctgatgatggt 161
>gb|BU981349.1|BU981349 HA23F03r HA Hordeum vulgare subsp. vulgare cDNA clone HA23F03
5-PRIME, mRNA sequence
Length = 509
Score = 42.1 bits (21), Expect = 0.023
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 617 atgaagcggttgccctggctgatgatggt 645
||||| ||||| |||||||||||||||||
Sbjct: 175 atgaaccggtttccctggctgatgatggt 147
>gb|BU995294.1|BU995294 HM09M17r HM Hordeum vulgare subsp. vulgare cDNA clone HM09M17
5-PRIME, mRNA sequence
Length = 585
Score = 42.1 bits (21), Expect = 0.023
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 617 atgaagcggttgccctggctgatgatggt 645
||||| ||||| |||||||||||||||||
Sbjct: 479 atgaaccggtttccctggctgatgatggt 451
>gb|CB881433.1|CB881433 HM09M17w HM Hordeum vulgare subsp. vulgare cDNA clone HM09M17
3-PRIME, mRNA sequence
Length = 490
Score = 42.1 bits (21), Expect = 0.023
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 617 atgaagcggttgccctggctgatgatggt 645
||||| ||||| |||||||||||||||||
Sbjct: 438 atgaaccggtttccctggctgatgatggt 466
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 69,341
Number of Sequences: 312970
Number of extensions: 69341
Number of successful extensions: 19204
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19196
Number of HSP's gapped (non-prelim): 8
length of query: 656
length of database: 175,134,539
effective HSP length: 19
effective length of query: 637
effective length of database: 169,188,109
effective search space: 107772825433
effective search space used: 107772825433
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)