BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.2
(595 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV916779.1|AV916779 AV916779 K. Sato unpublished cDNA li... 56 1e-006
gb|AV922076.1|AV922076 AV922076 K. Sato unpublished cDNA li... 56 1e-006
gb|AV930935.1|AV930935 AV930935 K. Sato unpublished cDNA li... 56 1e-006
gb|AV931472.1|AV931472 AV931472 K. Sato unpublished cDNA li... 56 1e-006
gb|CA032293.1|CA032293 HX12J15r HX Hordeum vulgare subsp. v... 56 1e-006
gb|BU969156.1|BU969156 HB10L09r BC Hordeum vulgare subsp. v... 52 2e-005
gb|BG343589.1|BG343589 HVSMEg0006H13f Hordeum vulgare pre-a... 44 0.005
gb|BU979822.1|BU979822 HA17H16r HA Hordeum vulgare subsp. v... 38 0.32
gb|BU986685.1|BU986685 HF12J22r HF Hordeum vulgare subsp. v... 38 0.32
>gb|AV916779.1|AV916779 AV916779 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags19j21 5', mRNA sequence
Length = 612
Score = 56.0 bits (28), Expect = 1e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 222 gtcatccactacaacggaaacctgaagccctggcttgagattgg 265
||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 447 gtcatacattacaatggcaacctgaagccctggcttgagattgg 490
>gb|AV922076.1|AV922076 AV922076 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags19j21 3', mRNA sequence
Length = 643
Score = 56.0 bits (28), Expect = 1e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 222 gtcatccactacaacggaaacctgaagccctggcttgagattgg 265
||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 278 gtcatacattacaatggcaacctgaagccctggcttgagattgg 235
>gb|AV930935.1|AV930935 AV930935 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25o11 3', mRNA sequence
Length = 495
Score = 56.0 bits (28), Expect = 1e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 222 gtcatccactacaacggaaacctgaagccctggcttgagattgg 265
||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 345 gtcatacattacaatggcaacctgaagccctggcttgagattgg 302
>gb|AV931472.1|AV931472 AV931472 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd19o15 3', mRNA sequence
Length = 635
Score = 56.0 bits (28), Expect = 1e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 222 gtcatccactacaacggaaacctgaagccctggcttgagattgg 265
||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 463 gtcatacattacaatggcaacctgaagccctggcttgagattgg 420
>gb|CA032293.1|CA032293 HX12J15r HX Hordeum vulgare subsp. vulgare cDNA clone HX12J15
5-PRIME, mRNA sequence
Length = 653
Score = 56.0 bits (28), Expect = 1e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 222 gtcatccactacaacggaaacctgaagccctggcttgagattgg 265
||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 291 gtcatacattacaatggcaacctgaagccctggcttgagattgg 248
>gb|BU969156.1|BU969156 HB10L09r BC Hordeum vulgare subsp. vulgare cDNA clone HB10L09
5-PRIME, mRNA sequence
Length = 684
Score = 52.0 bits (26), Expect = 2e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 222 gtcatccactacaacggaaacctgaagccctggc 255
||||||||||||||||||||| ||||||| ||||
Sbjct: 651 gtcatccactacaacggaaacatgaagccatggc 684
Score = 44.1 bits (22), Expect = 0.005
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 49 tctaccatacctggcagaagttgaatgaaaacaggctattgtggaa 94
||||||||| |||||||| |||||||||||||||| |||||||
Sbjct: 478 tctaccataagtggcagaacatgaatgaaaacaggctgctgtggaa 523
>gb|BG343589.1|BG343589 HVSMEg0006H13f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0006H13f, mRNA sequence
Length = 1018
Score = 44.1 bits (22), Expect = 0.005
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 241 acctgaagccctggcttgagat 262
||||||||||||||||||||||
Sbjct: 632 acctgaagccctggcttgagat 653
>gb|BU979822.1|BU979822 HA17H16r HA Hordeum vulgare subsp. vulgare cDNA clone HA17H16
5-PRIME, mRNA sequence
Length = 554
Score = 38.2 bits (19), Expect = 0.32
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 49 tctaccatacctggcagaagttgaatgaaaacagg 83
||||||||| |||||||| ||||||||||||||
Sbjct: 520 tctaccataagtggcagaacatgaatgaaaacagg 554
>gb|BU986685.1|BU986685 HF12J22r HF Hordeum vulgare subsp. vulgare cDNA clone HF12J22
5-PRIME, mRNA sequence
Length = 607
Score = 38.2 bits (19), Expect = 0.32
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 393 tttcttagaccaattcttt 411
|||||||||||||||||||
Sbjct: 390 tttcttagaccaattcttt 372
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 40,051
Number of Sequences: 312970
Number of extensions: 40051
Number of successful extensions: 8644
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8633
Number of HSP's gapped (non-prelim): 11
length of query: 595
length of database: 175,134,539
effective HSP length: 19
effective length of query: 576
effective length of database: 169,188,109
effective search space: 97452350784
effective search space used: 97452350784
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)