BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.1
(689 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ465104.1|BJ465104 BJ465104 K. Sato unpublished cDNA li... 52 2e-005
gb|BU968630.1|BU968630 HB08B19r BC Hordeum vulgare subsp. v... 52 2e-005
gb|CV055942.1|CV055942 BNEL12B7 Barley EST endosperm librar... 52 2e-005
gb|CK123727.1|CK123727 BES1824105d06 BES1824 Hordeum vulgar... 52 2e-005
gb|BG345023.1|BG345023 HVSMEg0018F09f Hordeum vulgare pre-a... 48 4e-004
gb|BJ447514.1|BJ447514 BJ447514 K. Sato unpublished cDNA li... 48 4e-004
gb|BJ455274.1|BJ455274 BJ455274 K. Sato unpublished cDNA li... 48 4e-004
gb|BU969156.1|BU969156 HB10L09r BC Hordeum vulgare subsp. v... 44 0.006
gb|BU979822.1|BU979822 HA17H16r HA Hordeum vulgare subsp. v... 44 0.006
>gb|BJ465104.1|BJ465104 BJ465104 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags37m09 5', mRNA sequence
Length = 598
Score = 52.0 bits (26), Expect = 2e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||||||||||||||| ||||| |||||||| ||||||
Sbjct: 282 atgcttgtggttgggcttatgggatgaacatctttgat 319
>gb|BU968630.1|BU968630 HB08B19r BC Hordeum vulgare subsp. vulgare cDNA clone HB08B19
5-PRIME, mRNA sequence
Length = 521
Score = 52.0 bits (26), Expect = 2e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||||||||||||||| ||||| |||||||| ||||||
Sbjct: 375 atgcttgtggttgggcttatgggatgaacatctttgat 412
>gb|CV055942.1|CV055942 BNEL12B7 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL12B7 5' similar to 68 kDa
protein, mRNA sequence
Length = 616
Score = 52.0 bits (26), Expect = 2e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||||||||||||||| ||||| |||||||| ||||||
Sbjct: 116 atgcttgtggttgggcttatgggatgaacatctttgat 153
>gb|CK123727.1|CK123727 BES1824105d06 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010D065 5-PRIME, mRNA sequence
Length = 786
Score = 52.0 bits (26), Expect = 2e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||||||||||||||| ||||| |||||||| ||||||
Sbjct: 155 atgcttgtggttgggcttatgggatgaacatctttgat 192
>gb|BG345023.1|BG345023 HVSMEg0018F09f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0018F09f, mRNA sequence
Length = 856
Score = 48.1 bits (24), Expect = 4e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 5 gcttgtggttgggcatatggcatgaacatgtttgat 40
|||||||||||||| ||||| |||||||| ||||||
Sbjct: 1 gcttgtggttgggcttatgggatgaacatctttgat 36
>gb|BJ447514.1|BJ447514 BJ447514 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak16a24 5', mRNA sequence
Length = 630
Score = 48.1 bits (24), Expect = 4e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 4 tgcttgtggttgggcatatggcatgaacatgtttga 39
||||||||||||||| | ||| ||||||||||||||
Sbjct: 127 tgcttgtggttgggcttttggaatgaacatgtttga 162
>gb|BJ455274.1|BJ455274 BJ455274 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak16a24 3', mRNA sequence
Length = 565
Score = 48.1 bits (24), Expect = 4e-004
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 4 tgcttgtggttgggcatatggcatgaacatgtttga 39
||||||||||||||| | ||| ||||||||||||||
Sbjct: 443 tgcttgtggttgggcttttggaatgaacatgtttga 408
>gb|BU969156.1|BU969156 HB10L09r BC Hordeum vulgare subsp. vulgare cDNA clone HB10L09
5-PRIME, mRNA sequence
Length = 684
Score = 44.1 bits (22), Expect = 0.006
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 75 tctaccatacctggcagaagttgaatgaaaacaggctattgtggaa 120
||||||||| |||||||| |||||||||||||||| |||||||
Sbjct: 478 tctaccataagtggcagaacatgaatgaaaacaggctgctgtggaa 523
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||| ||||||||||| ||||| ||||| |||||||||
Sbjct: 406 atgcatgtggttgggcttatggaatgaatatgtttgat 443
>gb|BU979822.1|BU979822 HA17H16r HA Hordeum vulgare subsp. vulgare cDNA clone HA17H16
5-PRIME, mRNA sequence
Length = 554
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||| ||||||||||| ||||| ||||| |||||||||
Sbjct: 448 atgcatgtggttgggcttatggaatgaatatgtttgat 485
Score = 38.2 bits (19), Expect = 0.37
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 75 tctaccatacctggcagaagttgaatgaaaacagg 109
||||||||| |||||||| ||||||||||||||
Sbjct: 520 tctaccataagtggcagaacatgaatgaaaacagg 554
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 45,096
Number of Sequences: 312970
Number of extensions: 45096
Number of successful extensions: 10658
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10646
Number of HSP's gapped (non-prelim): 12
length of query: 689
length of database: 175,134,539
effective HSP length: 19
effective length of query: 670
effective length of database: 169,188,109
effective search space: 113356033030
effective search space used: 113356033030
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)