BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750436.2.1
(656 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY247215.1| Hordeum vulgare subsp. vulgare syntaxin-like... 250 5e-065
gb|BQ458502.1|BQ458502 HA05A10r HA Hordeum vulgare subsp. v... 123 8e-027
gb|CB880180.1|CB880180 HM05L22w HM Hordeum vulgare subsp. v... 74 6e-012
gb|CB881364.1|CB881364 HM09J09w HM Hordeum vulgare subsp. v... 74 6e-012
gb|AY246906.1| Hordeum vulgare subsp. vulgare syntaxin (Ror... 74 6e-012
gb|AY246907.1| Hordeum vulgare subsp. vulgare syntaxin (Ror... 74 6e-012
gb|BQ764328.1|BQ764328 EBan01_SQ005_E13_R anther, yellow st... 40 0.089
gb|CB879337.1|CB879337 HP11M23T HP Hordeum vulgare subsp. v... 40 0.089
gb|BG301122.1|BG301122 HVSMEb0019K06f Hordeum vulgare seedl... 38 0.35
>gb|AY247215.1| Hordeum vulgare subsp. vulgare syntaxin-like protein 2 gene,
partial cds
Length = 931
Score = 250 bits (126), Expect = 5e-065
Identities = 286/339 (84%), Gaps = 3/339 (0%)
Strand = Plus / Minus
Query: 318 gaggagcagcaggattatgatgccgatgcagagacacttgcggctgcttctctggtactc 377
||||||||||||||| ||||||||||||||| ||||||||||||| | ||||| ||
Sbjct: 903 gaggagcagcaggat---gatgccgatgcagaggcacttgcggctgccgcgctggtgctg 847
Query: 378 cttggccttgcccagctccttgttgccgccctgcacgtagtgggaggcgttggcgacgtg 437
|||||||| ||||||||||||||| || ||||||| |||||||| || ||
Sbjct: 846 acgagccttgccgagctccttgttgccggagtggacgtagtccctggcgttggtcacctg 787
Query: 438 gctctcgatgtcgtcgagcttctccccctgcgtctccaccatgacggccatgtcgaggaa 497
| ||||||| |||||||||||||||||||||| || ||| | ||||||||||||||||||
Sbjct: 786 gttctcgatatcgtcgagcttctccccctgcgactgcacgacgacggccatgtcgaggaa 727
Query: 498 cacttggtggagctccaggaggctgcgttccacctcgcgcgccgcgtcacggcggncctg 557
|| ||||||||||| ||||||||||| |||||||| | || ||||| ||||| ||||
Sbjct: 726 gacctggtggagctcgaggaggctgcgctccacctccctggcggcgtcgtggcggtcctg 667
Query: 558 gatctcgtgcaccgcggcgagcacggcgcccttgccgtgctccgcgacagcggcgcccag 617
|||||||| | |||||||||||| ||||||||||||||||| ||||| ||||||| ||
Sbjct: 666 gatctcgttgagcgcggcgagcaccgcgcccttgccgtgctcggcgacggcggcgctcat 607
Query: 618 gagctcctcgccgcggtcgtcggagatgatgcgctcgat 656
|| ||||||||||||| | ||||||||||||||||||||
Sbjct: 606 gatctcctcgccgcggccctcggagatgatgcgctcgat 568
>gb|BQ458502.1|BQ458502 HA05A10r HA Hordeum vulgare subsp. vulgare cDNA clone HA05A10
5-PRIME, mRNA sequence
Length = 456
Score = 123 bits (62), Expect = 8e-027
Identities = 97/109 (88%)
Strand = Plus / Minus
Query: 548 ggcggncctggatctcgtgcaccgcggcgagcacggcgcccttgccgtgctccgcgacag 607
||||| |||||||||||| | |||||||||||| ||||||||||||||||| ||||| |
Sbjct: 433 ggcggtcctggatctcgttgagcgcggcgagcaccgcgcccttgccgtgctcggcgacgg 374
Query: 608 cggcgcccaggagctcctcgccgcggtcgtcggagatgatgcgctcgat 656
|||||| || || ||||||||||||| | ||||||||||||||||||||
Sbjct: 373 cggcgctcatgatctcctcgccgcggccctcggagatgatgcgctcgat 325
>gb|CB880180.1|CB880180 HM05L22w HM Hordeum vulgare subsp. vulgare cDNA clone HM05L22
3-PRIME, mRNA sequence
Length = 600
Score = 73.8 bits (37), Expect = 6e-012
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 431 cgacgtggctctcgatgtcgtcgagcttctccccctgcgtctccaccatgacggccatgt 490
||||||||| |||||||||||| |||| ||||||||||| | |||||| ||||||||||
Sbjct: 345 cgacgtggccctcgatgtcgtccagctgctccccctgcgccgccaccagcacggccatgt 404
Query: 491 cgaggaacacttggtggagctccag 515
|| |||||| || || ||||||||
Sbjct: 405 cgttgaacacctgctgcagctccag 429
>gb|CB881364.1|CB881364 HM09J09w HM Hordeum vulgare subsp. vulgare cDNA clone HM09J09
3-PRIME, mRNA sequence
Length = 515
Score = 73.8 bits (37), Expect = 6e-012
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 431 cgacgtggctctcgatgtcgtcgagcttctccccctgcgtctccaccatgacggccatgt 490
||||||||| |||||||||||| |||| ||||||||||| | |||||| ||||||||||
Sbjct: 345 cgacgtggccctcgatgtcgtccagctgctccccctgcgccgccaccagcacggccatgt 404
Query: 491 cgaggaacacttggtggagctccag 515
|| |||||| || || ||||||||
Sbjct: 405 cgttgaacacctgctgcagctccag 429
>gb|AY246906.1| Hordeum vulgare subsp. vulgare syntaxin (Ror2) gene, complete cds
Length = 2346
Score = 73.8 bits (37), Expect = 6e-012
Identities = 73/85 (85%)
Strand = Plus / Minus
Query: 431 cgacgtggctctcgatgtcgtcgagcttctccccctgcgtctccaccatgacggccatgt 490
||||||||| |||||||||||| |||| ||||||||||| | |||||| ||||||||||
Sbjct: 1825 cgacgtggccctcgatgtcgtccagctgctccccctgcgccgccaccagcacggccatgt 1766
Query: 491 cgaggaacacttggtggagctccag 515
|| |||||| || || ||||||||
Sbjct: 1765 cgttgaacacctgctgcagctccag 1741
>gb|AY246907.1| Hordeum vulgare subsp. vulgare syntaxin (Ror2) mRNA, complete cds
Length = 1293
Score = 73.8 bits (37), Expect = 6e-012
Identities = 73/85 (85%)
Strand = Plus / Minus
Query: 431 cgacgtggctctcgatgtcgtcgagcttctccccctgcgtctccaccatgacggccatgt 490
||||||||| |||||||||||| |||| ||||||||||| | |||||| ||||||||||
Sbjct: 944 cgacgtggccctcgatgtcgtccagctgctccccctgcgccgccaccagcacggccatgt 885
Query: 491 cgaggaacacttggtggagctccag 515
|| |||||| || || ||||||||
Sbjct: 884 cgttgaacacctgctgcagctccag 860
>gb|BQ764328.1|BQ764328 EBan01_SQ005_E13_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ005_E13 5', mRNA sequence
Length = 520
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 611 cgcccaggagctcctcgccg 630
||||||||||||||||||||
Sbjct: 299 cgcccaggagctcctcgccg 280
>gb|CB879337.1|CB879337 HP11M23T HP Hordeum vulgare subsp. vulgare cDNA clone HP11M23
5-PRIME, mRNA sequence
Length = 700
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 611 cgcccaggagctcctcgccg 630
||||||||||||||||||||
Sbjct: 375 cgcccaggagctcctcgccg 394
>gb|BG301122.1|BG301122 HVSMEb0019K06f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0019K06f, mRNA sequence
Length = 619
Score = 38.2 bits (19), Expect = 0.35
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 313 aggacgaggagcagcagga 331
|||||||||||||||||||
Sbjct: 116 aggacgaggagcagcagga 98
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 88,175
Number of Sequences: 312970
Number of extensions: 88175
Number of successful extensions: 28377
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28365
Number of HSP's gapped (non-prelim): 10
length of query: 656
length of database: 175,134,539
effective HSP length: 19
effective length of query: 637
effective length of database: 169,188,109
effective search space: 107772825433
effective search space used: 107772825433
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)