BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2655972.2.1
         (666 letters)

Database: Hordeum_nucl_with_EST.fasta 
           312,970 sequences; 175,134,539 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU977027.1|BU977027  HA10L12r HA Hordeum vulgare subsp. v...    96   2e-018
gb|BU977028.1|BU977028  HA10L12u HA Hordeum vulgare subsp. v...    96   2e-018
gb|CA026473.1|CA026473  HZ56A06r HZ Hordeum vulgare subsp. v...    96   2e-018
>gb|BU977027.1|BU977027 HA10L12r HA Hordeum vulgare subsp. vulgare cDNA clone HA10L12
           5-PRIME, mRNA sequence
          Length = 472

 Score = 95.6 bits (48), Expect = 2e-018
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
           ||||||||||||||| || ||||||||| |||||||||| |||||||| || || |||| 
Sbjct: 53  gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 112

                                                   
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
           |||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 113 caagataaaggagcagagtgcgagagtgtggaacatatta 152

 Score = 58.0 bits (29), Expect = 4e-007
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
           ||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 175 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 223
>gb|BU977028.1|BU977028 HA10L12u HA Hordeum vulgare subsp. vulgare cDNA clone HA10L12
           3-PRIME, mRNA sequence
          Length = 472

 Score = 95.6 bits (48), Expect = 2e-018
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
           ||||||||||||||| || ||||||||| |||||||||| |||||||| || || |||| 
Sbjct: 420 gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 361

                                                   
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
           |||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 360 caagataaaggagcagagtgcgagagtgtggaacatatta 321

 Score = 58.0 bits (29), Expect = 4e-007
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
           ||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 298 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 250
>gb|CA026473.1|CA026473 HZ56A06r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ56A06
           5-PRIME, mRNA sequence
          Length = 503

 Score = 95.6 bits (48), Expect = 2e-018
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
           ||||||||||||||| || ||||||||| |||||||||| |||||||| || || |||| 
Sbjct: 53  gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 112

                                                   
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
           |||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 113 caagataaaggagcagagtgcgagagtgtggaacatatta 152

 Score = 58.0 bits (29), Expect = 4e-007
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
           ||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 175 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 223
  Database: Hordeum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:16 PM
  Number of letters in database: 175,134,539
  Number of sequences in database:  312,970
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 44,576
Number of Sequences: 312970
Number of extensions: 44576
Number of successful extensions: 10397
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10388
Number of HSP's gapped (non-prelim): 9
length of query: 666
length of database: 175,134,539
effective HSP length: 19
effective length of query: 647
effective length of database: 169,188,109
effective search space: 109464706523
effective search space used: 109464706523
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)