BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2623051.2.1
(991 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW982401.2|AW982401 HVSMEg0003C19f Hordeum vulgare pre-a... 244 5e-063
gb|BM371446.2|BM371446 EBma08_SQ002_M06_R maternal, 28 DPA,... 113 1e-023
gb|AL504252.1|AL504252 AL504252 Hordeum vulgare Barke roots... 88 6e-016
gb|AL504719.1|AL504719 AL504719 Hordeum vulgare Barke roots... 88 6e-016
gb|BI951782.1|BI951782 HVSMEm0002M12f Hordeum vulgare green... 88 6e-016
gb|BJ453869.1|BJ453869 BJ453869 K. Sato unpublished cDNA li... 88 6e-016
gb|CK125116.1|CK125116 BES1824106l24 BES1824 Hordeum vulgar... 88 6e-016
gb|BJ461404.1|BJ461404 BJ461404 K. Sato unpublished cDNA li... 82 4e-014
gb|BI947127.1|BI947127 HVSMEl0003N07f Hordeum vulgare spike... 80 2e-013
gb|BQ465184.1|BQ465184 HU02O05r HU Hordeum vulgare subsp. v... 64 9e-009
gb|BQ762675.1|BQ762675 EBro02_SQ004_O15 _R root, 3 week, hy... 64 9e-009
gb|BQ766925.1|BQ766925 EBro08_SQ007_B17_R root, 3 week, dro... 64 9e-009
gb|CA008912.1|CA008912 HU12I03r HU Hordeum vulgare subsp. v... 64 9e-009
gb|CA012046.1|CA012046 HT04E15r HT Hordeum vulgare subsp. v... 64 9e-009
gb|BF064456.3|BF064456 HV_CEb0015C20f Hordeum vulgare seedl... 62 4e-008
gb|BG344635.2|BG344635 HVSMEg0009O02f Hordeum vulgare pre-a... 58 6e-007
gb|BQ663493.1|BQ663493 HU02O05u HU Hordeum vulgare subsp. v... 54 9e-006
gb|CV053763.1|CV053763 BNEL102h5 Barley EST endosperm libra... 54 9e-006
gb|CV058220.1|CV058220 BNEL35f4 Barley EST endosperm librar... 54 9e-006
gb|CV059054.1|CV059054 BNEL43h11 Barley EST endosperm libra... 54 9e-006
gb|BI949828.1|BI949828 HVSMEl0016E24f Hordeum vulgare spike... 52 4e-005
gb|BU999352.1|BU999352 HI14D21r HI Hordeum vulgare subsp. v... 44 0.009
gb|BF256379.2|BF256379 HVSMEf0009H01f Hordeum vulgare seedl... 42 0.034
gb|AW983246.3|AW983246 HVSMEg0008O09f Hordeum vulgare pre-a... 42 0.034
gb|BI778941.2|BI778941 EBro01_SQ002_C23_R root, 3 week, hyd... 42 0.034
gb|CA020757.1|CA020757 HZ37J16r HZ Hordeum vulgare subsp. v... 42 0.034
gb|CA028316.1|CA028316 HZ61J24r HZ Hordeum vulgare subsp. v... 42 0.034
gb|AY672068.1| Hordeum vulgare subsp. vulgare myb transcrip... 42 0.034
gb|BF265531.3|BF265531 HV_CEa0012I06f Hordeum vulgare seedl... 40 0.14
gb|AV912905.1|AV912905 AV912905 K. Sato unpublished cDNA li... 40 0.14
gb|AV913203.1|AV913203 AV913203 K. Sato unpublished cDNA li... 40 0.14
gb|AV915032.1|AV915032 AV915032 K. Sato unpublished cDNA li... 40 0.14
gb|AV915303.1|AV915303 AV915303 K. Sato unpublished cDNA li... 40 0.14
gb|AV917656.1|AV917656 AV917656 K. Sato unpublished cDNA li... 40 0.14
gb|AV920163.1|AV920163 AV920163 K. Sato unpublished cDNA li... 40 0.14
gb|AV925675.1|AV925675 AV925675 K. Sato unpublished cDNA li... 40 0.14
gb|AV930818.1|AV930818 AV930818 K. Sato unpublished cDNA li... 40 0.14
gb|BJ463522.1|BJ463522 BJ463522 K. Sato unpublished cDNA li... 40 0.14
gb|BJ464336.1|BJ464336 BJ464336 K. Sato unpublished cDNA li... 40 0.14
gb|BJ466353.1|BJ466353 BJ466353 K. Sato unpublished cDNA li... 40 0.14
gb|BJ466471.1|BJ466471 BJ466471 K. Sato unpublished cDNA li... 40 0.14
gb|BJ466778.1|BJ466778 BJ466778 K. Sato unpublished cDNA li... 40 0.14
gb|BJ468102.1|BJ468102 BJ468102 K. Sato unpublished cDNA li... 40 0.14
gb|BQ471424.1|BQ471424 HV02G06r HV Hordeum vulgare subsp. v... 40 0.14
gb|BQ471958.1|BQ471958 HV03P22r HV Hordeum vulgare subsp. v... 40 0.14
gb|BU999742.1|BU999742 HI15J05r HI Hordeum vulgare subsp. v... 40 0.14
>gb|AW982401.2|AW982401 HVSMEg0003C19f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0003C19f, mRNA sequence
Length = 873
Score = 244 bits (123), Expect = 5e-063
Identities = 192/215 (89%)
Strand = Plus / Minus
Query: 442 gggctgcttccgcttcagcaggtgtgacttgagcttcttcatgtcggccggcttcacggg 501
||||||||||||| | |||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 215 gggctgcttccgccggaccaggtgagacttgagcttcttcatgtcggcgagcttcacggg 156
Query: 502 cttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggcacgtt 561
||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||
Sbjct: 155 cttgaggaagaactcctccgcgccatcctccaagcacctgctgatcctggcaggcacatt 96
Query: 562 ctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttcactcgcgt 621
|||||| |||||||||||||||||||||||| | || || || |||||||| || | | |
Sbjct: 95 ctcagaggacatgatcaccaccggaatgtccttcagtgaggatgaccccttgaccctcct 36
Query: 622 gagcagatcgtatcctgtcatgccgggcatgcagt 656
||||||||||||||||||||||| ||||||||||
Sbjct: 35 cagcagatcgtatcctgtcatgcccggcatgcagt 1
>gb|BM371446.2|BM371446 EBma08_SQ002_M06_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_M06 5', mRNA sequence
Length = 615
Score = 113 bits (57), Expect = 1e-023
Identities = 81/89 (91%)
Strand = Plus / Minus
Query: 442 gggctgcttccgcttcagcaggtgtgacttgagcttcttcatgtcggccggcttcacggg 501
||||||||||||| | |||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 93 gggctgcttccgccggaccaggtgagacttgagcttcttcatgtcggcgagcttcacggg 34
Query: 502 cttcaggaagaactcctccgcgccatcct 530
||| |||||||||||||||||||||||||
Sbjct: 33 cttgaggaagaactcctccgcgccatcct 5
>gb|AL504252.1|AL504252 AL504252 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW04L02V 5', mRNA sequence
Length = 700
Score = 87.7 bits (44), Expect = 6e-016
Identities = 50/52 (96%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 399 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcagtgatgatgag 348
Score = 73.8 bits (37), Expect = 1e-011
Identities = 90/108 (83%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||| | ||||| |||||| | || || ||||||| ||| |||||
Sbjct: 262 gccttggtcccagaatccncagtggtaacttggaacgaagatgtcttgaggagcctctcg 203
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 202 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 155
>gb|AL504719.1|AL504719 AL504719 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW06C24V 5', mRNA sequence
Length = 699
Score = 87.7 bits (44), Expect = 6e-016
Identities = 50/52 (96%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 392 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcagtgatgatgag 341
Score = 79.8 bits (40), Expect = 2e-013
Identities = 91/108 (84%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| | || || ||||||| ||| |||||
Sbjct: 255 gccttggtcccagaatccacagtggtaacttggaacgaagatgtcttgaggagcctctcg 196
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 195 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 148
>gb|BI951782.1|BI951782 HVSMEm0002M12f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0002M12f, mRNA sequence
Length = 812
Score = 87.7 bits (44), Expect = 6e-016
Identities = 134/164 (81%)
Strand = Plus / Minus
Query: 532 caagcacctgctgatccgggcaggcacgttctcagacgacatgatcaccaccggaatgtc 591
||||| ||||||||| | | ||||||| |||||| | ||||||||||| || ||||||||
Sbjct: 230 caagcgcctgctgattctgtcaggcacattctcataggacatgatcacaacaggaatgtc 171
Query: 592 cgtgagcgatgaggaccccttcactcgcgtgagcagatcgtatcctgtcatgccgggcat 651
| | | || |||||||| || | | | | ||||||||||||||||||||| |||||
Sbjct: 170 ctcaccccaggatgaccccttgaccctcataaacagatcgtatcctgtcatgcccggcat 111
Query: 652 gcagtagtcagtgatgatgagactcacgtcgatctcctgatggt 695
|||||||||||||||||| | | ||||| | | |||||||||||
Sbjct: 110 gcagtagtcagtgatgatcaaattcacgcccacctcctgatggt 67
>gb|BJ453869.1|BJ453869 BJ453869 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak44m13 5', mRNA sequence
Length = 641
Score = 87.7 bits (44), Expect = 6e-016
Identities = 50/52 (96%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 245 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcagtgatgatgag 194
Score = 79.8 bits (40), Expect = 2e-013
Identities = 91/108 (84%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| | || || ||||||| ||| |||||
Sbjct: 108 gccttggtcccagaatccacagtggtaacttggaacgaagatgtcttgaggagcctctcg 49
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 48 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 1
>gb|CK125116.1|CK125116 BES1824106l24 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010L246 5-PRIME, mRNA sequence
Length = 777
Score = 87.7 bits (44), Expect = 6e-016
Identities = 50/52 (96%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 382 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcagtgatgatgag 331
Score = 79.8 bits (40), Expect = 2e-013
Identities = 91/108 (84%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| | || || ||||||| ||| |||||
Sbjct: 245 gccttggtcccagaatccacagtggtaacttggaacgaagatgtcttgaggagcctctcg 186
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 185 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 138
>gb|BJ461404.1|BJ461404 BJ461404 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak44m13 3', mRNA sequence
Length = 651
Score = 81.8 bits (41), Expect = 4e-014
Identities = 49/52 (94%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 599 tgagcagatcgtatcctgtcatcccangcatgcagtagtcagtgatgatgag 650
>gb|BI947127.1|BI947127 HVSMEl0003N07f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0003N07f, mRNA sequence
Length = 1057
Score = 79.8 bits (40), Expect = 2e-013
Identities = 91/108 (84%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| | || || ||||||| ||| |||||
Sbjct: 247 gccttggtcccagaatccacagtggtaacttggaacgaagatgtcttgaggagcctctcg 188
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 187 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 140
>gb|BQ465184.1|BQ465184 HU02O05r HU Hordeum vulgare subsp. vulgare cDNA clone HU02O05
5-PRIME, mRNA sequence
Length = 627
Score = 63.9 bits (32), Expect = 9e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 140 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 81
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| ||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 80 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatgat 25
>gb|BQ762675.1|BQ762675 EBro02_SQ004_O15 _R root, 3 week, hydroponic grown, low nitrogen,
cv Optic, EBro02 Hordeum vulgare subsp. vulgare cDNA
clone EBro02_SQ004_O15 5', mRNA sequence
Length = 571
Score = 63.9 bits (32), Expect = 9e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 554 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 495
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| ||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 494 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatgat 439
>gb|BQ766925.1|BQ766925 EBro08_SQ007_B17_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ007_B17 5', mRNA sequence
Length = 554
Score = 63.9 bits (32), Expect = 9e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 535 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 476
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| ||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 475 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatgat 420
>gb|CA008912.1|CA008912 HU12I03r HU Hordeum vulgare subsp. vulgare cDNA clone HU12I03
5-PRIME, mRNA sequence
Length = 488
Score = 63.9 bits (32), Expect = 9e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 208 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 149
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| ||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 148 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatgat 93
>gb|CA012046.1|CA012046 HT04E15r HT Hordeum vulgare subsp. vulgare cDNA clone HT04E15
5-PRIME, mRNA sequence
Length = 533
Score = 63.9 bits (32), Expect = 9e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 495 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 436
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| ||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 435 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatgat 380
>gb|BF064456.3|BF064456 HV_CEb0015C20f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0015C20f, mRNA sequence
Length = 622
Score = 61.9 bits (31), Expect = 4e-008
Identities = 94/115 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 115 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 56
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatga 668
|| ||| ||||||| ||||| || |||||||||||||| |||||||| |||||||
Sbjct: 55 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtcggtgatga 1
>gb|BG344635.2|BG344635 HVSMEg0009O02f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0009O02f, mRNA sequence
Length = 835
Score = 58.0 bits (29), Expect = 6e-007
Identities = 44/49 (89%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
||||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 463 tgagcagctcgtaccccgtcatgccgggcattcagtagtcggtgatgat 415
>gb|BQ663493.1|BQ663493 HU02O05u HU Hordeum vulgare subsp. vulgare cDNA clone HU02O05
3-PRIME, mRNA sequence
Length = 593
Score = 54.0 bits (27), Expect = 9e-006
Identities = 87/107 (81%)
Strand = Plus / Plus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||| || || || || ||| |||| || ||| ||||
Sbjct: 487 ggcacgttctccgacgacatgatgacgacggggatctcccggagctccgacgactccttg 546
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtc 660
|| ||| ||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 547 acgcgcttgagcagctcgtaccccgtcatgccgggcatccagtagtc 593
>gb|CV053763.1|CV053763 BNEL102h5 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL102h5 5' similar to Oryza sativa,
mRNA sequence
Length = 439
Score = 54.0 bits (27), Expect = 9e-006
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 828 tcttgagcagcatctcgatgagcttcc 854
|||||||||||||||||||||||||||
Sbjct: 169 tcttgagcagcatctcgatgagcttcc 195
>gb|CV058220.1|CV058220 BNEL35f4 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL35f4 5' similar to Oryza sativa,
mRNA sequence
Length = 439
Score = 54.0 bits (27), Expect = 9e-006
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 828 tcttgagcagcatctcgatgagcttcc 854
|||||||||||||||||||||||||||
Sbjct: 169 tcttgagcagcatctcgatgagcttcc 195
>gb|CV059054.1|CV059054 BNEL43h11 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL43h11 5' similar to Oryza sativa,
mRNA sequence
Length = 439
Score = 54.0 bits (27), Expect = 9e-006
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 828 tcttgagcagcatctcgatgagcttcc 854
|||||||||||||||||||||||||||
Sbjct: 169 tcttgagcagcatctcgatgagcttcc 195
>gb|BI949828.1|BI949828 HVSMEl0016E24f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0016E24f, mRNA sequence
Length = 456
Score = 52.0 bits (26), Expect = 4e-005
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 700 ggaggacgacgacgaagatgaggaggagga 729
|||||||||||||||||| |||||||||||
Sbjct: 69 ggaggacgacgacgaagaggaggaggagga 98
>gb|BU999352.1|BU999352 HI14D21r HI Hordeum vulgare subsp. vulgare cDNA clone HI14D21
5-PRIME, mRNA sequence
Length = 644
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 700 ggaggacgacgacgaagatgaggaggagga 729
|||||||||||| ||||| |||||||||||
Sbjct: 112 ggaggacgacgaggaagaggaggaggagga 141
>gb|BF256379.2|BF256379 HVSMEf0009H01f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0009H01f, mRNA sequence
Length = 255
Score = 42.1 bits (21), Expect = 0.034
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 719 gaggaggaggatgacggcggcgacg 743
||||||||||| |||||||||||||
Sbjct: 84 gaggaggaggaggacggcggcgacg 60
>gb|AW983246.3|AW983246 HVSMEg0008O09f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0008O09f, mRNA sequence
Length = 821
Score = 42.1 bits (21), Expect = 0.034
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 706 cgacgacgaagatgaggaggaggatgacg 734
|||||||||| ||||||||||||| ||||
Sbjct: 174 cgacgacgaatatgaggaggaggaggacg 202
>gb|BI778941.2|BI778941 EBro01_SQ002_C23_R root, 3 week, hydroponic grown, no treatment, cv
Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
EBro01_SQ002_C23 5', mRNA sequence
Length = 568
Score = 42.1 bits (21), Expect = 0.034
Identities = 72/89 (80%)
Strand = Plus / Minus
Query: 497 acgggcttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggc 556
|||||||| | || ||||||||||||||| || | | ||||| || ||||| ||| ||
Sbjct: 459 acgggcttgatgaggaactcctccgcgccctcgtcgaggcaccggcggatcctggcgggg 400
Query: 557 acgttctcagacgacatgatcaccaccgg 585
|||||| || |||||||||||||||||
Sbjct: 399 gagttctcggatgacatgatcaccaccgg 371
Score = 42.1 bits (21), Expect = 0.034
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 609 ccttcactcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatga 668
||||||| ||| | ||||| ||||| || ||||| | |||||||||||||| |||||||
Sbjct: 347 ccttcacccgcttcagcaggtcgtagccggtcatctccggcatgcagtagtccgtgatga 288
Query: 669 t 669
|
Sbjct: 287 t 287
>gb|CA020757.1|CA020757 HZ37J16r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ37J16
5-PRIME, mRNA sequence
Length = 544
Score = 42.1 bits (21), Expect = 0.034
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 719 gaggaggaggatgacggcggcgacg 743
||||||||||| |||||||||||||
Sbjct: 78 gaggaggaggaggacggcggcgacg 54
>gb|CA028316.1|CA028316 HZ61J24r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ61J24
5-PRIME, mRNA sequence
Length = 548
Score = 42.1 bits (21), Expect = 0.034
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 719 gaggaggaggatgacggcggcgacg 743
||||||||||| |||||||||||||
Sbjct: 112 gaggaggaggaggacggcggcgacg 88
>gb|AY672068.1| Hordeum vulgare subsp. vulgare myb transcription factor mRNA,
complete cds
Length = 1542
Score = 42.1 bits (21), Expect = 0.034
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggaggatga 732
||||| |||||||| ||||||||||||||
Sbjct: 669 gacgaagacgaagaggaggaggaggatga 641
>gb|BF265531.3|BF265531 HV_CEa0012I06f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0012I06f, mRNA sequence
Length = 768
Score = 40.1 bits (20), Expect = 0.14
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 351 ccagctccagctcgtgcaccggct 374
||||||||||||| ||||||||||
Sbjct: 59 ccagctccagctcctgcaccggct 82
>gb|AV912905.1|AV912905 AV912905 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags10o13 5', mRNA sequence
Length = 607
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 581 catctcgacgagcttcctgttgatgatg 554
>gb|AV913203.1|AV913203 AV913203 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21e05 5', mRNA sequence
Length = 615
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 610 catctcgacgagcttcctgttgatgatg 583
>gb|AV915032.1|AV915032 AV915032 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9i11 5', mRNA sequence
Length = 619
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 439 catctcgacgagcttcctgttgatgatg 412
>gb|AV915303.1|AV915303 AV915303 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags13m21 5', mRNA sequence
Length = 612
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 585 catctcgacgagcttcctgttgatgatg 558
>gb|AV917656.1|AV917656 AV917656 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags10o13 3', mRNA sequence
Length = 700
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 629 catctcgacgagcttcctgttgatgatg 656
>gb|AV920163.1|AV920163 AV920163 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9i11 3', mRNA sequence
Length = 749
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 629 catctcgacgagcttcctgttgatgatg 656
>gb|AV925675.1|AV925675 AV925675 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25f17 5', mRNA sequence
Length = 632
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 568 catctcgacgagcttcctgttgatgatg 541
>gb|AV930818.1|AV930818 AV930818 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25f17 3', mRNA sequence
Length = 680
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 620 catctcgacgagcttcctgttgatgatg 647
>gb|BJ463522.1|BJ463522 BJ463522 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags32e17 5', mRNA sequence
Length = 625
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 598 catctcgacgagcttcctgttgatgatg 571
>gb|BJ464336.1|BJ464336 BJ464336 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags33n24 5', mRNA sequence
Length = 582
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 559 catctcgacgagcttcctgttgatgatg 532
>gb|BJ466353.1|BJ466353 BJ466353 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags31l22 3', mRNA sequence
Length = 665
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 593 catctcgacgagcttcctgttgatgatg 620
>gb|BJ466471.1|BJ466471 BJ466471 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags32e17 3', mRNA sequence
Length = 693
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 596 catctcgacgagcttcctgttgatgatg 623
>gb|BJ466778.1|BJ466778 BJ466778 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags33n24 3', mRNA sequence
Length = 666
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 623 catctcgacgagcttcctgttgatgatg 650
>gb|BJ468102.1|BJ468102 BJ468102 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags37b21 3', mRNA sequence
Length = 658
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 630 catctcgacgagcttcctgttgatgatg 657
>gb|BQ471424.1|BQ471424 HV02G06r HV Hordeum vulgare subsp. vulgare cDNA clone HV02G06
5-PRIME, mRNA sequence
Length = 597
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 572 catctcgacgagcttcctgttgatgatg 545
>gb|BQ471958.1|BQ471958 HV03P22r HV Hordeum vulgare subsp. vulgare cDNA clone HV03P22
5-PRIME, mRNA sequence
Length = 482
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 838 catctcgatgagcttcctgtcgatgatg 865
|||||||| ||||||||||| |||||||
Sbjct: 44 catctcgacgagcttcctgttgatgatg 17
>gb|BU999742.1|BU999742 HI15J05r HI Hordeum vulgare subsp. vulgare cDNA clone HI15J05
5-PRIME, mRNA sequence
Length = 211
Score = 40.1 bits (20), Expect = 0.14
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 698 ggggaggacgacgacgaagatgaggagg 725
|||||||| ||||||||||| |||||||
Sbjct: 74 ggggaggaggacgacgaagaggaggagg 47
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 193,815
Number of Sequences: 312970
Number of extensions: 193815
Number of successful extensions: 53256
Number of sequences better than 0.5: 46
Number of HSP's better than 0.5 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53162
Number of HSP's gapped (non-prelim): 92
length of query: 991
length of database: 175,134,539
effective HSP length: 19
effective length of query: 972
effective length of database: 169,188,109
effective search space: 164450841948
effective search space used: 164450841948
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)