BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419536.2.1
(1366 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF628874.2|BF628874 HVSMEb0009A12f Hordeum vulgare seedl... 70 2e-010
gb|AW982411.2|AW982411 HVSMEg0003D05f Hordeum vulgare pre-a... 62 5e-008
gb|BI956571.1|BI956571 HVSMEn0004D06f Hordeum vulgare rachi... 62 5e-008
gb|BI957606.1|BI957606 HVSMEn0010F15f Hordeum vulgare rachi... 54 1e-005
gb|BI958645.1|BI958645 HVSMEn0016A21f Hordeum vulgare rachi... 54 1e-005
gb|BI960501.1|BI960501 HVSMEn0024N01f Hordeum vulgare rachi... 54 1e-005
gb|BG343272.2|BG343272 HVSMEg0005E13f Hordeum vulgare pre-a... 54 1e-005
gb|BG344915.2|BG344915 HVSMEg0016N12f Hordeum vulgare pre-a... 54 1e-005
gb|BI959987.1|BI959987 HVSMEn0022M02f Hordeum vulgare rachi... 52 5e-005
gb|AV913364.1|AV913364 AV913364 K. Sato unpublished cDNA li... 52 5e-005
gb|AV918663.1|AV918663 AV918663 K. Sato unpublished cDNA li... 52 5e-005
gb|BI957257.1|BI957257 HVSMEn0008H11f Hordeum vulgare rachi... 48 8e-004
gb|BQ134680.1|BQ134680 LP30153 Lemma/palea-enriched cDNA li... 48 8e-004
gb|BI936373.1|BI936373 HVSMEa0019K09f Hordeum vulgare seedl... 46 0.003
gb|AL450506.1|AL450506 AL450506 Hordeum vulgare Barke etiol... 44 0.012
gb|AL506209.1|AL506209 AL506209 Hordeum vulgare Barke devel... 44 0.012
gb|AL506259.1|AL506259 AL506259 Hordeum vulgare Barke devel... 44 0.012
gb|AL506370.1|AL506370 AL506370 Hordeum vulgare Barke devel... 44 0.012
gb|AL506401.1|AL506401 AL506401 Hordeum vulgare Barke devel... 44 0.012
gb|AL506516.1|AL506516 AL506516 Hordeum vulgare Barke devel... 44 0.012
gb|AL506522.1|AL506522 AL506522 Hordeum vulgare Barke devel... 44 0.012
gb|AL507196.1|AL507196 AL507196 Hordeum vulgare Barke devel... 44 0.012
gb|AL507342.1|AL507342 AL507342 Hordeum vulgare Barke devel... 44 0.012
gb|AL507475.1|AL507475 AL507475 Hordeum vulgare Barke devel... 44 0.012
gb|AL508024.1|AL508024 AL508024 Hordeum vulgare Barke devel... 44 0.012
gb|AL508218.1|AL508218 AL508218 Hordeum vulgare Barke devel... 44 0.012
gb|AV836790.1|AV836790 AV836790 K. Sato unpublished cDNA li... 44 0.012
gb|BE215581.1|BE215581 HV_CEb0008D04f Hordeum vulgare seedl... 44 0.012
gb|BF627522.2|BF627522 HVSMEb0005B08f Hordeum vulgare seedl... 44 0.012
gb|BF630467.2|BF630467 HVSMEb0009L10f Hordeum vulgare seedl... 44 0.012
gb|BG308957.1|BG308957 HVSMEc0001A22f Hordeum vulgare seedl... 44 0.012
gb|BG343003.1|BG343003 HVSMEg0001K17f Hordeum vulgare pre-a... 44 0.012
gb|BG344974.1|BG344974 HVSMEg0018C02f Hordeum vulgare pre-a... 44 0.012
gb|BG368118.1|BG368118 HVSMEi0015M03f Hordeum vulgare 20 DA... 44 0.012
gb|BI952215.1|BI952215 HVSMEm0005B08f Hordeum vulgare green... 44 0.012
gb|BE215178.2|BE215178 HV_CEb0006B08f Hordeum vulgare seedl... 44 0.012
gb|BE230918.2|BE230918 HVSMEg0001K02f Hordeum vulgare pre-a... 44 0.012
gb|BG301246.2|BG301246 HVSMEb0020D01f Hordeum vulgare seedl... 44 0.012
gb|AW983321.3|AW983321 HVSMEg0010D10f Hordeum vulgare pre-a... 44 0.012
gb|BG345139.2|BG345139 HVSMEg0018N19f Hordeum vulgare pre-a... 44 0.012
gb|BE194864.3|BE194864 HVSMEh0087E22f Hordeum vulgare 5-45 ... 44 0.012
gb|BG366626.2|BG366626 HVSMEi0007K17f Hordeum vulgare 20 DA... 44 0.012
gb|BF264626.3|BF264626 HV_CEa0009O22f Hordeum vulgare seedl... 44 0.012
gb|AV925555.1|AV925555 AV925555 K. Sato unpublished cDNA li... 44 0.012
gb|AV932583.1|AV932583 AV932583 K. Sato unpublished cDNA li... 44 0.012
gb|BM817329.1|BM817329 HC105E06_T3.ab1 HC Hordeum vulgare s... 44 0.012
gb|BJ463928.1|BJ463928 BJ463928 K. Sato unpublished cDNA li... 44 0.012
gb|BJ466194.1|BJ466194 BJ466194 K. Sato unpublished cDNA li... 44 0.012
gb|BJ468779.1|BJ468779 BJ468779 K. Sato unpublished cDNA li... 44 0.012
gb|BJ472520.1|BJ472520 BJ472520 K. Sato unpublished cDNA li... 44 0.012
gb|BQ462614.1|BQ462614 HI01H16T HI Hordeum vulgare subsp. v... 44 0.012
gb|BQ462950.1|BQ462950 HI02I12r HI Hordeum vulgare subsp. v... 44 0.012
gb|BQ466651.1|BQ466651 HS01C15T HS Hordeum vulgare subsp. v... 44 0.012
gb|BQ466973.1|BQ466973 HS02C15r HS Hordeum vulgare subsp. v... 44 0.012
gb|BQ467239.1|BQ467239 HS03C01r HS Hordeum vulgare subsp. v... 44 0.012
gb|BQ467324.1|BQ467324 HS03G13r HS Hordeum vulgare subsp. v... 44 0.012
gb|BQ294531.1|BQ294531 LP10296 Lemma/palea-enriched cDNA li... 44 0.012
gb|BQ658222.1|BQ658222 HA05D15u HA Hordeum vulgare subsp. v... 44 0.012
gb|BQ659524.1|BQ659524 HE01L03u HE Hordeum vulgare subsp. v... 44 0.012
gb|BI776761.2|BI776761 EBpi07_SQ001_K21_R pistil, 12 DPA, n... 44 0.012
gb|BI779186.2|BI779186 EBro01_SQ003_E02_R root, 3 week, hyd... 44 0.012
gb|BM443332.2|BM443332 EBro02_SQ003_K02_R root, 3 week, hyd... 44 0.012
gb|BM443485.2|BM443485 EBro02_SQ005_F13_R root, 3 week, hyd... 44 0.012
gb|BQ765257.1|BQ765257 EBro03_SQ006_L18_R root, 3 week, wat... 44 0.012
gb|BU974771.1|BU974771 HB29A24r BC Hordeum vulgare subsp. v... 44 0.012
gb|BU995433.1|BU995433 HM10D22r HM Hordeum vulgare subsp. v... 44 0.012
gb|BU995565.1|BU995565 HM10K06r HM Hordeum vulgare subsp. v... 44 0.012
gb|BU996350.1|BU996350 HM13F06r HM Hordeum vulgare subsp. v... 44 0.012
gb|BU996461.1|BU996461 HM13L01r HM Hordeum vulgare subsp. v... 44 0.012
gb|BU996974.1|BU996974 HI06H15r HI Hordeum vulgare subsp. v... 44 0.012
gb|BU998832.1|BU998832 HI12E19r HI Hordeum vulgare subsp. v... 44 0.012
gb|BU998946.1|BU998946 HI12K19r HI Hordeum vulgare subsp. v... 44 0.012
gb|BU999496.1|BU999496 HI14L03r HI Hordeum vulgare subsp. v... 44 0.012
gb|CA001695.1|CA001695 HS05F01r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA002049.1|CA002049 HS06F20r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA002979.1|CA002979 HS09A24r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA003174.1|CA003174 HS09K05r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA003269.1|CA003269 HS09O17r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA003761.1|CA003761 HS15H17r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA004423.1|CA004423 HS17I16r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA004582.1|CA004582 HS18A21r HS Hordeum vulgare subsp. v... 44 0.012
gb|CA017488.1|CA017488 HV05F19r HV Hordeum vulgare subsp. v... 44 0.012
gb|CA017586.1|CA017586 HV05K03r HV Hordeum vulgare subsp. v... 44 0.012
gb|CA023365.1|CA023365 HZ46A02r HZ Hordeum vulgare subsp. v... 44 0.012
gb|CA024414.1|CA024414 HZ49D24r HZ Hordeum vulgare subsp. v... 44 0.012
gb|CA027315.1|CA027315 HZ58H19r HZ Hordeum vulgare subsp. v... 44 0.012
gb|CA028511.1|CA028511 HZ62E02r HZ Hordeum vulgare subsp. v... 44 0.012
gb|CA028539.1|CA028539 HZ62F18r HZ Hordeum vulgare subsp. v... 44 0.012
gb|CA030057.1|CA030057 HX05P08r HX Hordeum vulgare subsp. v... 44 0.012
gb|CA030531.1|CA030531 HX07F12r HX Hordeum vulgare subsp. v... 44 0.012
gb|CA032321.1|CA032321 HX12K20r HX Hordeum vulgare subsp. v... 44 0.012
gb|CA032918.1|CA032918 HX14J09r HX Hordeum vulgare subsp. v... 44 0.012
gb|CB877071.1|CB877071 HP03H10T HP Hordeum vulgare subsp. v... 44 0.012
gb|CB879734.1|CB879734 HP03H10w HP Hordeum vulgare subsp. v... 44 0.012
gb|CB883153.1|CB883153 HQ01F24w HQ Hordeum vulgare subsp. v... 44 0.012
gb|CB883636.1|CB883636 HQ02N11w HQ Hordeum vulgare subsp. v... 44 0.012
gb|AL504432.1|AL504432 AL504432 Hordeum vulgare Barke roots... 42 0.048
gb|BF622277.2|BF622277 HVSMEa0002I03f Hordeum vulgare seedl... 40 0.19
>gb|BF628874.2|BF628874 HVSMEb0009A12f Hordeum vulgare seedling shoot EST library HVcDNA0002
(Dehydration stress) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEb0009A12f, mRNA sequence
Length = 875
Score = 69.9 bits (35), Expect = 2e-010
Identities = 164/207 (79%)
Strand = Plus / Plus
Query: 846 tgcatgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattc 905
||||||||||| | | || |||||| | || ||||| || |||||||| || |||||
Sbjct: 102 tgcatgattggagcgacgatgactgcatcaaaatactaaaaaattgcaataaagctatcg 161
Query: 906 ctccaagagaagccggtggaaaggtgataataataaacatggtagttggagctgggccat 965
|||||| ||| || || |||||||||||||| || ||||||| ||||| | || ||
Sbjct: 162 ctccaaaagatgctggcggaaaggtgataattgtagacatggtggttggtggaggcccgc 221
Query: 966 ctgacatgaagcacaaagagatgcaggccatattcgatgtctatatcatgttcatcaatg 1025
||| ||||||||||||||| || | | | |||||| | || |||||| || ||||||
Sbjct: 222 aagacctgaagcacaaagagacacaagtcttgttcgatctttacatcatgctcctcaatg 281
Query: 1026 gcatggaacgagatgagcaggagtgga 1052
|||| ||||||||||||||||||||||
Sbjct: 282 gcatcgaacgagatgagcaggagtgga 308
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 791 ggcgacatgtttgagagcattccac 815
|||||||||||||||||||||||||
Sbjct: 47 ggcgacatgtttgagagcattccac 71
>gb|AW982411.2|AW982411 HVSMEg0003D05f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0003D05f, mRNA sequence
Length = 1041
Score = 61.9 bits (31), Expect = 5e-008
Identities = 91/111 (81%)
Strand = Plus / Plus
Query: 705 cgttcccgcacgtcaagtgtagcgtgctggaccttgcccacgtcgttgcgaaggctccaa 764
||||||||||| ||||||| |||||| ||||||| | ||| ||| |||| |||||| |
Sbjct: 442 cgttcccgcacatcaagtgcagcgtgatggacctcggccatgtcattgccggggctccta 501
Query: 765 ctcacacggacgtgcaatttatcgctggcgacatgtttgagagcattccac 815
| ||| |||||||| | || || |||||||||||||||||||||||||
Sbjct: 502 gtggcaccgacgtgcagtacattgcgggcgacatgtttgagagcattccac 552
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 173 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 226
Score = 50.1 bits (25), Expect = 2e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 846 tgcatgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattc 905
||||||||||| | | || |||||| | || ||||| || |||||||| || |||||
Sbjct: 583 tgcatgattggagcgacgatgactgcatcaaaatactaaaaaattgcaataaagctatcg 642
Query: 906 ctccaagagaagccggtggaaaggtgataataataaacatggtagttgg 954
|||||| ||| || || |||||||||||||| |||||||||| |||||
Sbjct: 643 ctccaaaagatgctggcggaaaggtgataattgtaaacatggtggttgg 691
>gb|BI956571.1|BI956571 HVSMEn0004D06f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0004D06f, mRNA sequence
Length = 780
Score = 61.9 bits (31), Expect = 5e-008
Identities = 91/111 (81%)
Strand = Plus / Plus
Query: 705 cgttcccgcacgtcaagtgtagcgtgctggaccttgcccacgtcgttgcgaaggctccaa 764
||||||||||| ||||||| |||||| ||||||| | ||| ||| |||| |||||| |
Sbjct: 460 cgttcccgcacatcaagtgcagcgtgatggacctcggccatgtcattgccggggctccta 519
Query: 765 ctcacacggacgtgcaatttatcgctggcgacatgtttgagagcattccac 815
| ||| |||||||| | || || |||||||||||||||||||||||||
Sbjct: 520 gtggcaccgacgtgcagtacattgcgggcgacatgtttgagagcattccac 570
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 191 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 244
>gb|BI957606.1|BI957606 HVSMEn0010F15f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0010F15f, mRNA sequence
Length = 648
Score = 54.0 bits (27), Expect = 1e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
||||||||||| |||||||||||||||||||
Sbjct: 60 ttgctcgatgctcagctcgagctctggcaca 90
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 410 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 463
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 147 gccgacgccatccaccaccatggcggtgccgc 178
>gb|BI958645.1|BI958645 HVSMEn0016A21f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0016A21f, mRNA sequence
Length = 624
Score = 54.0 bits (27), Expect = 1e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
||||||||||| |||||||||||||||||||
Sbjct: 67 ttgctcgatgctcagctcgagctctggcaca 97
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 417 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 470
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 154 gccgacgccatccaccaccatggcggtgccgc 185
>gb|BI960501.1|BI960501 HVSMEn0024N01f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0024N01f, mRNA sequence
Length = 660
Score = 54.0 bits (27), Expect = 1e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
||||||||||| |||||||||||||||||||
Sbjct: 59 ttgctcgatgctcagctcgagctctggcaca 89
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 409 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 462
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 146 gccgacgccatccaccaccatggcggtgccgc 177
>gb|BG343272.2|BG343272 HVSMEg0005E13f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0005E13f, mRNA sequence
Length = 992
Score = 54.0 bits (27), Expect = 1e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
||||||||||| |||||||||||||||||||
Sbjct: 65 ttgctcgatgctcagctcgagctctggcaca 95
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 415 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 468
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 152 gccgacgccatccaccaccatggcggtgccgc 183
Score = 42.1 bits (21), Expect = 0.048
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 705 cgttcccgcacgtcaagtgtagcgtgctggacc 737
||||||||||| ||||||| |||||| ||||||
Sbjct: 684 cgttcccgcacatcaagtgcagcgtgatggacc 716
>gb|BG344915.2|BG344915 HVSMEg0016N12f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0016N12f, mRNA sequence
Length = 635
Score = 54.0 bits (27), Expect = 1e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 416 catcgtctcctccttctctgaactcggngcctggttccagcacaagctgccaga 469
Score = 54.0 bits (27), Expect = 1e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
||||||||||| |||||||||||||||||||
Sbjct: 66 ttgctcgatgctcagctcgagctctggcaca 96
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 153 gccgacgccatccaccaccatggcggtgccgc 184
>gb|BI959987.1|BI959987 HVSMEn0022M02f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0022M02f, mRNA sequence
Length = 629
Score = 52.0 bits (26), Expect = 5e-005
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 436 catcgtctcccccttctccgagctcggcgcgtggttccagcacgagctcccaga 489
|||||||||| ||||||| || ||||| || |||||||||||| |||| |||||
Sbjct: 410 catcgtctcctccttctctgaactcggggcctggttccagcacaagctgccaga 463
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 147 gccgacgccatccaccaccatggcggtgccgc 178
>gb|AV913364.1|AV913364 AV913364 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m21 5', mRNA sequence
Length = 665
Score = 52.0 bits (26), Expect = 5e-005
Identities = 134/170 (78%)
Strand = Plus / Plus
Query: 545 gacgcgaccttcgacgccctagtcaacgacgggttggcttccgacagccaactcatcgtc 604
||||| ||||||||||| || |||| |||||| ||| || ||||||| ||||| |
Sbjct: 135 gacgccaccttcgacgcgctgatcaatgacgggatggtctcggacagccgcttcatcatg 194
Query: 605 gacgttgccatcaagcagagcgcagaggtcttccaggggataagctcgctcgtcgacgtc 664
||| | ||| ||||| || ||| ||||||||||||||||||| |||| | || ||||||
Sbjct: 195 gacatcgccgtcaaggagtgcggcgaggtcttccaggggataacctcgttggtagacgtc 254
Query: 665 ggtgggggcatcggtacggcggcccaagccatctcaaaggcgttcccgca 714
|| || ||| |||| |||| | || || ||||| ||||||||||||||
Sbjct: 255 ggcggtggcctcggcgcggcatctcaggcaatctccaaggcgttcccgca 304
>gb|AV918663.1|AV918663 AV918663 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m21 3', mRNA sequence
Length = 612
Score = 52.0 bits (26), Expect = 5e-005
Identities = 134/170 (78%)
Strand = Plus / Minus
Query: 545 gacgcgaccttcgacgccctagtcaacgacgggttggcttccgacagccaactcatcgtc 604
||||| ||||||||||| || |||| |||||| ||| || ||||||| ||||| |
Sbjct: 490 gacgccaccttcgacgcgctgatcaatgacgggatggtctcggacagccgcttcatcatg 431
Query: 605 gacgttgccatcaagcagagcgcagaggtcttccaggggataagctcgctcgtcgacgtc 664
||| | ||| ||||| || ||| ||||||||||||||||||| |||| | || ||||||
Sbjct: 430 gacatcgccgtcaaggagtgcggcgaggtcttccaggggataacctcgttggtagacgtc 371
Query: 665 ggtgggggcatcggtacggcggcccaagccatctcaaaggcgttcccgca 714
|| || ||| |||| |||| | || || ||||| ||||||||||||||
Sbjct: 370 ggcggtggcctcggcgcggcatctcaggcaatctccaaggcgttcccgca 321
>gb|BI957257.1|BI957257 HVSMEn0008H11f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0008H11f, mRNA sequence
Length = 446
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 167 gccgatgccatccacctccatggcggtgccgc 198
||||| |||||||||| |||||||||||||||
Sbjct: 154 gccgacgccatccaccaccatggcggtgccgc 185
Score = 48.1 bits (24), Expect = 8e-004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcaca 110
|||||| |||| |||||||||||||||||||
Sbjct: 67 ttgctcnatgctcagctcgagctctggcaca 97
>gb|BQ134680.1|BQ134680 LP30153 Lemma/palea-enriched cDNA library from dough stage of kernel
Hordeum vulgare subsp. vulgare cDNA clone 3-153 similar
to Hexaprenyldihydroxybenzoate
methyltransferase,(S)-scoulerine 9-O-methyltransferase,
mRNA sequence
Length = 255
Score = 48.1 bits (24), Expect = 8e-004
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 1034 cgagatgagcaggagtggagcaagattttctccgaagctggatatagcgattaca 1088
||||| ||||| |||||||| |||||||||| |||||||| | |||||| ||||
Sbjct: 20 cgagangagcatgagtggaggaagattttcttagaagctgggtttagcgactaca 74
>gb|BI936373.1|BI936373 HVSMEa0019K09f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0019K09f, mRNA sequence
Length = 651
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 629 gaggtcttccaggggataagctcgctcgtcgacgtcggt 667
||||||||||| ||||||| |||| | ||||||||||||
Sbjct: 574 gaggtcttccatgggataacctcgttggtcgacgtcggt 612
>gb|AL450506.1|AL450506 AL450506 Hordeum vulgare Barke etiolated leaves Hordeum vulgare
subsp. vulgare cDNA clone HK01I14u 5', mRNA sequence
Length = 581
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 231 cacggacaagagcaagctcgatgcgcagcccgagctct 268
>gb|AL506209.1|AL506209 AL506209 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY02G06T 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 215 cacggacaagagcaagctcgatgcgcagcccgagctct 252
>gb|AL506259.1|AL506259 AL506259 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY02I21T 5',
mRNA sequence
Length = 686
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 223 cacggacaagagcaagctcgatgcgcagcccgagctct 260
>gb|AL506370.1|AL506370 AL506370 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY02O09T 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 215 cacggacaagagcaagctcgatgcgcagcccgagctct 252
>gb|AL506401.1|AL506401 AL506401 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY03A01T 5',
mRNA sequence
Length = 699
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 229 cacggacaagagcaagctcgatgcgcagcccgagctct 266
>gb|AL506516.1|AL506516 AL506516 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY03G09T 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 228 cacggacaagagcaagctcgatgcgcagcccgagctct 265
>gb|AL506522.1|AL506522 AL506522 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY03G18T 5',
mRNA sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 211 cacggacaagagcaagctcgatgcgcagcccgagctct 248
>gb|AL507196.1|AL507196 AL507196 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY01B01V 5',
mRNA sequence
Length = 445
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 212 cacggacaagagcaagctcgatgcgcagcccgagctct 249
>gb|AL507342.1|AL507342 AL507342 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY05B05V 5',
mRNA sequence
Length = 631
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 224 cacggacaagagcaagctcgatgcgcagcccgagctct 261
>gb|AL507475.1|AL507475 AL507475 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY05N18V 5',
mRNA sequence
Length = 668
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 217 cacggacaagagcaagctcgatgcgcagcccgagctct 254
>gb|AL508024.1|AL508024 AL508024 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY07I21V 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 214 cacggacaagagcaagctcgatgcgcagcccgagctct 251
>gb|AL508218.1|AL508218 AL508218 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY08B23V 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 225 cacggacaagagcaagctcgatgcgcagcccgagctct 262
>gb|AV836790.1|AV836790 AV836790 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd3c22, mRNA
sequence
Length = 696
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 701 aaggcgttcccgcacgtcaagtgtagcgtgctggacct 738
||||| ||||| ||||||||||| | ||||||||||||
Sbjct: 524 aaggcattcccacacgtcaagtgcaccgtgctggacct 487
>gb|BE215581.1|BE215581 HV_CEb0008D04f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0008D04f, mRNA sequence
Length = 532
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 845 ttgcatgattgggaccatgacgactgcgtgaagatact 882
|||||||| |||| ||| |||||||||||||||||||
Sbjct: 199 ttgcatgactggggccactacgactgcgtgaagatact 236
>gb|BF627522.2|BF627522 HVSMEb0005B08f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0005B08f, mRNA sequence
Length = 759
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 231 cacggacaagagcaagctcgatgcgcagcccgagctct 268
>gb|BF630467.2|BF630467 HVSMEb0009L10f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0009L10f, mRNA sequence
Length = 727
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 213 cacggacaagagcaagctcgatgcgcagcccgagctct 250
>gb|BG308957.1|BG308957 HVSMEc0001A22f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0001A22f, mRNA sequence
Length = 842
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 218 cacggacaagagcaagctcgatgcgcagcccgagctct 255
>gb|BG343003.1|BG343003 HVSMEg0001K17f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0001K17f, mRNA sequence
Length = 848
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 225 cacggacaagagcaagctcgatgcgcagcccgagctct 262
>gb|BG344974.1|BG344974 HVSMEg0018C02f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0018C02f, mRNA sequence
Length = 883
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 230 cacggacaagagcaagctcgatgcgcagcccgagctct 267
>gb|BG368118.1|BG368118 HVSMEi0015M03f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0015M03f, mRNA sequence
Length = 839
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 147 cacggacaagagcaagctcgatgcgcagcccgagctct 184
>gb|BI952215.1|BI952215 HVSMEm0005B08f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0005B08f, mRNA sequence
Length = 429
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 212 cacggacaagagcaagctcgatgcgcagcccgagctct 249
>gb|BE215178.2|BE215178 HV_CEb0006B08f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0006B08f, mRNA sequence
Length = 477
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 218 cacggacaagagcaagctcgatgcgcagcccgagctct 255
>gb|BE230918.2|BE230918 HVSMEg0001K02f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0001K02f, mRNA sequence
Length = 608
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 113 cacggacaagagcaagctcgatgcgcagcccgagctct 150
>gb|BG301246.2|BG301246 HVSMEb0020D01f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0020D01f, mRNA sequence
Length = 900
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 222 cacggacaagagcaagctcgatgcgcagcccgagctct 259
>gb|AW983321.3|AW983321 HVSMEg0010D10f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0010D10f, mRNA sequence
Length = 815
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 233 cacggacaagagcaagctcgatgcgcagcccgagctct 270
>gb|BG345139.2|BG345139 HVSMEg0018N19f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0018N19f, mRNA sequence
Length = 815
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 183 cacggacaagagcaagctcgatgcgcagcccgagctct 220
>gb|BE194864.3|BE194864 HVSMEh0087E22f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0087E22f, mRNA sequence
Length = 658
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 221 cacggacaagagcaagctcgatgcgcagcccgagctct 258
>gb|BG366626.2|BG366626 HVSMEi0007K17f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0007K17f, mRNA sequence
Length = 498
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 216 cacggacaagagcaagctcgatgcgcagcccgagctct 253
>gb|BF264626.3|BF264626 HV_CEa0009O22f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0009O22f, mRNA sequence
Length = 877
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 845 ttgcatgattgggaccatgacgactgcgtgaagatact 882
|||||||| |||| ||| ||||||||||| ||||||||
Sbjct: 109 ttgcatgactggggccacgacgactgcgtcaagatact 146
>gb|AV925555.1|AV925555 AV925555 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd24n12 5', mRNA sequence
Length = 616
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 210 cacggacaagagcaagctcgatgcgcagcccgagctct 247
>gb|AV932583.1|AV932583 AV932583 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal1e03 5', mRNA sequence
Length = 595
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 211 cacggacaagagcaagctcgatgcgcagcccgagctct 248
>gb|BM817329.1|BM817329 HC105E06_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC105E06_T3.ab1 similar to Hexaprenyldihydroxybenzoate
methyltransferase,(S)-scoulerine 9-O-methyltransferase,
mRNA sequence
Length = 885
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 701 aaggcgttcccgcacgtcaagtgtagcgtgctggacct 738
||||| ||||| ||||||||||| | ||||||||||||
Sbjct: 345 aaggcattcccacacgtcaagtgcaccgtgctggacct 382
Score = 40.1 bits (20), Expect = 0.19
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 789 ctggcgacatgtttgagagcattccaccagcagacgccgt 828
||||||||||||||||| ||| ||||| |||||| ||||
Sbjct: 433 ctggcgacatgtttgagtacatcccaccggcagacaccgt 472
>gb|BJ463928.1|BJ463928 BJ463928 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags31b15 5', mRNA sequence
Length = 519
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 218 cacggacaagagcaagctcgatgcgcagcccgagctct 255
>gb|BJ466194.1|BJ466194 BJ466194 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags31b15 3', mRNA sequence
Length = 694
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 569 cacggacaagagcaagctcgatgcgcagcccgagctct 532
>gb|BJ468779.1|BJ468779 BJ468779 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd27d16 5', mRNA sequence
Length = 611
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 241 cacggacaagagcaagctcgatgcgcagcccgagctct 278
>gb|BJ472520.1|BJ472520 BJ472520 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal35a08 5', mRNA sequence
Length = 522
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 67 cacggaccagagcttgctcgatgcgcagctcgagctct 104
||||||| ||||| |||||||||||||| ||||||||
Sbjct: 212 cacggacaagagcaagctcgatgcgcagcccgagctct 249
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 133,882
Number of Sequences: 312970
Number of extensions: 133882
Number of successful extensions: 38504
Number of sequences better than 0.5: 98
Number of HSP's better than 0.5 without gapping: 98
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38340
Number of HSP's gapped (non-prelim): 161
length of query: 1366
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1347
effective length of database: 169,188,109
effective search space: 227896382823
effective search space used: 227896382823
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)