BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2404800.2.1
(1228 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF628874.2|BF628874 HVSMEb0009A12f Hordeum vulgare seedl... 86 3e-015
gb|BI956571.1|BI956571 HVSMEn0004D06f Hordeum vulgare rachi... 78 8e-013
gb|AW982411.2|AW982411 HVSMEg0003D05f Hordeum vulgare pre-a... 74 1e-011
gb|AV913364.1|AV913364 AV913364 K. Sato unpublished cDNA li... 74 1e-011
gb|AV918663.1|AV918663 AV918663 K. Sato unpublished cDNA li... 74 1e-011
gb|BI957606.1|BI957606 HVSMEn0010F15f Hordeum vulgare rachi... 72 5e-011
gb|BI957639.1|BI957639 HVSMEn0010H12f Hordeum vulgare rachi... 72 5e-011
gb|BI958645.1|BI958645 HVSMEn0016A21f Hordeum vulgare rachi... 72 5e-011
gb|BI959987.1|BI959987 HVSMEn0022M02f Hordeum vulgare rachi... 72 5e-011
gb|BI960501.1|BI960501 HVSMEn0024N01f Hordeum vulgare rachi... 72 5e-011
gb|BG343272.2|BG343272 HVSMEg0005E13f Hordeum vulgare pre-a... 72 5e-011
gb|BG344915.2|BG344915 HVSMEg0016N12f Hordeum vulgare pre-a... 72 5e-011
gb|BI936373.1|BI936373 HVSMEa0019K09f Hordeum vulgare seedl... 66 3e-009
gb|BI957257.1|BI957257 HVSMEn0008H11f Hordeum vulgare rachi... 56 3e-006
gb|BF259471.1|BF259471 HVSMEf0019D06f Hordeum vulgare seedl... 52 4e-005
gb|BM817329.1|BM817329 HC105E06_T3.ab1 HC Hordeum vulgare s... 50 2e-004
gb|AL504432.1|AL504432 AL504432 Hordeum vulgare Barke roots... 48 7e-004
gb|AV836790.1|AV836790 AV836790 K. Sato unpublished cDNA li... 44 0.011
gb|AL508558.1|AL508558 AL508558 Hordeum vulgare Barke devel... 42 0.043
gb|BG300340.1|BG300340 HVSMEb0012K19f Hordeum vulgare seedl... 42 0.043
gb|BQ471376.1|BQ471376 HV02E01r HV Hordeum vulgare subsp. v... 42 0.043
gb|BF621551.2|BF621551 HVSMEa0011G01f Hordeum vulgare seedl... 40 0.17
gb|BQ469638.1|BQ469638 HZ01G17r HZ Hordeum vulgare subsp. v... 40 0.17
gb|BQ469780.1|BQ469780 HZ01N15r HZ Hordeum vulgare subsp. v... 40 0.17
gb|CV064017.1|CV064017 BNEL96d7 Barley EST endosperm librar... 40 0.17
>gb|BF628874.2|BF628874 HVSMEb0009A12f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0009A12f, mRNA sequence
Length = 875
Score = 85.7 bits (43), Expect = 3e-015
Identities = 223/283 (78%)
Strand = Plus / Minus
Query: 252 attatctttttccactcatgttcgtctcgctcggcgccattgatcgtcatgatgaagaga 311
|||||||| |||||||| || || ||||| ||| |||||||| ||||||| | |||
Sbjct: 318 attatcttcttccactcctgctcatctcgttcgatgccattgaggagcatgatgtaaaga 259
Query: 312 tcaaacaagacctgagtctctttgtgcttaatgtttgacgactggcctccaacaaccata 371
|| |||||||| || |||||||||||||| | || | || || ||||| |||||
Sbjct: 258 tcgaacaagacttgtgtctctttgtgcttcaggtcttgcgggcctccaccaaccaccatg 199
Query: 372 tcaacgattatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttg 431
|| || |||||||||||||| || ||||| | | || |||||||| || || || ||
Sbjct: 198 tctacaattatcacctttccgccagcatcttttggagcgatagctttattgcaatttttt 139
Query: 432 agtatcttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcg 491
||||| ||||| || ||| | |||| ||| ||||||| || |||||| |||||||| |
Sbjct: 138 agtattttgatgcagtcatcgtcgctccaatcatgcataatccactttaggaagacaaca 79
Query: 492 tctgccggtggaatgctctcaaacatgtcgccagcaatatact 534
|||||| ||||||||||||||||||||||||| ||||| ||||
Sbjct: 78 tctgcctgtggaatgctctcaaacatgtcgcccgcaatgtact 36
>gb|BI956571.1|BI956571 HVSMEn0004D06f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0004D06f, mRNA sequence
Length = 780
Score = 77.8 bits (39), Expect = 8e-013
Identities = 87/103 (84%)
Strand = Plus / Minus
Query: 432 agtatcttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcg 491
||||| ||||| || ||| | |||| ||| ||||||| || |||||| |||||||| |
Sbjct: 637 agtattttgatgcagtcatcgtcgctccaatcatgcataatccactttaggaagacaaca 578
Query: 492 tctgccggtggaatgctctcaaacatgtcgccagcaatatact 534
|||||| ||||||||||||||||||||||||| ||||| ||||
Sbjct: 577 tctgcctgtggaatgctctcaaacatgtcgcccgcaatgtact 535
Score = 50.1 bits (25), Expect = 2e-004
Identities = 61/73 (83%)
Strand = Plus / Minus
Query: 642 cctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactccttgacg 701
|||||||| |||||||| ||||||| | |||| ||||||| |||||||||| ||| |
Sbjct: 427 cctccggcaacgtcgaccagggagcctataccctcgaagacgctgccgcactccctgatg 368
Query: 702 acgatgtccatga 714
||||||||||||
Sbjct: 367 gcgatgtccatga 355
>gb|AW982411.2|AW982411 HVSMEg0003D05f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0003D05f, mRNA sequence
Length = 1041
Score = 73.8 bits (37), Expect = 1e-011
Identities = 127/157 (80%)
Strand = Plus / Minus
Query: 378 attatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagtatc 437
|||||||||||||| || ||||| | | || |||||||| || || || || |||||
Sbjct: 673 attatcacctttccgccagcatcttttggagcgatagctttattgcaattttttagtatt 614
Query: 438 ttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaagacggcgtctgcc 497
||||| || ||| | |||| ||| ||||||| || |||||| || ||||| | ||||||
Sbjct: 613 ttgatgcagtcatcgtcgctccaatcatgcataatccactttagaaagacaacatctgcc 554
Query: 498 ggtggaatgctctcaaacatgtcgccagcaatatact 534
||||||||||||||||||||||||| ||||| ||||
Sbjct: 553 tgtggaatgctctcaaacatgtcgcccgcaatgtact 517
Score = 50.1 bits (25), Expect = 2e-004
Identities = 61/73 (83%)
Strand = Plus / Minus
Query: 642 cctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactccttgacg 701
|||||||| |||||||| ||||||| | |||| ||||||| |||||||||| ||| |
Sbjct: 409 cctccggcaacgtcgaccagggagcctataccctcgaagacgctgccgcactccctgatg 350
Query: 702 acgatgtccatga 714
||||||||||||
Sbjct: 349 gcgatgtccatga 337
>gb|AV913364.1|AV913364 AV913364 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m21 5', mRNA sequence
Length = 665
Score = 73.8 bits (37), Expect = 1e-011
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 676 ggaagacgtcgccgcactccttgacgacgatgtccatgacgaagctgctgtcgcagacca 735
||||||| |||||||||||||||||| |||||||||||| ||||| |||||| ||||||
Sbjct: 228 ggaagacctcgccgcactccttgacggcgatgtccatgatgaagcggctgtccgagacca 169
Query: 736 t 736
|
Sbjct: 168 t 168
>gb|AV918663.1|AV918663 AV918663 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m21 3', mRNA sequence
Length = 612
Score = 73.8 bits (37), Expect = 1e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 676 ggaagacgtcgccgcactccttgacgacgatgtccatgacgaagctgctgtcgcagacca 735
||||||| |||||||||||||||||| |||||||||||| ||||| |||||| ||||||
Sbjct: 397 ggaagacctcgccgcactccttgacggcgatgtccatgatgaagcggctgtccgagacca 456
Query: 736 t 736
|
Sbjct: 457 t 457
>gb|BI957606.1|BI957606 HVSMEn0010F15f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0010F15f,
mRNA sequence
Length = 648
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 279 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 220
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 219 acgggtggagcg 208
Score = 44.1 bits (22), Expect = 0.011
Identities = 60/73 (82%)
Strand = Plus / Minus
Query: 642 cctccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactccttgacg 701
|||||||| |||||||| ||||||| | ||| ||||||| |||||||||| ||| |
Sbjct: 646 cctccggcaacgtcgaccagggagcctataccttngaagacgctgccgcactccctgatg 587
Query: 702 acgatgtccatga 714
||||||||||||
Sbjct: 586 gcgatgtccatga 574
Score = 40.1 bits (20), Expect = 0.17
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1183 caaaggatgtgtgccagagctctagctgagcgtcaagcaa 1222
||||||| ||||||||||||| |||||||| || |||||
Sbjct: 99 caaaggagatgtgccagagctcgagctgagcatcgagcaa 60
>gb|BI957639.1|BI957639 HVSMEn0010H12f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0010H12f,
mRNA sequence
Length = 652
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 266 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 207
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 206 acgggtggagcg 195
>gb|BI958645.1|BI958645 HVSMEn0016A21f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0016A21f,
mRNA sequence
Length = 624
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 286 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 227
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 226 acgggtggagcg 215
Score = 40.1 bits (20), Expect = 0.17
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1183 caaaggatgtgtgccagagctctagctgagcgtcaagcaa 1222
||||||| ||||||||||||| |||||||| || |||||
Sbjct: 106 caaaggagatgtgccagagctcgagctgagcatcgagcaa 67
>gb|BI959987.1|BI959987 HVSMEn0022M02f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0022M02f,
mRNA sequence
Length = 629
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 279 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 220
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 219 acgggtggagcg 208
>gb|BI960501.1|BI960501 HVSMEn0024N01f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0024N01f,
mRNA sequence
Length = 660
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 278 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 219
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 218 acgggtggagcg 207
Score = 40.1 bits (20), Expect = 0.17
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1183 caaaggatgtgtgccagagctctagctgagcgtcaagcaa 1222
||||||| ||||||||||||| |||||||| || |||||
Sbjct: 98 caaaggagatgtgccagagctcgagctgagcatcgagcaa 59
>gb|BG343272.2|BG343272 HVSMEg0005E13f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0005E13f, mRNA sequence
Length = 992
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 284 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 225
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 224 acgggtggagcg 213
Score = 40.1 bits (20), Expect = 0.17
Identities = 57/70 (81%)
Strand = Plus / Minus
Query: 645 ccggcgacgtcgacaagggagctcagaccccggaagacgtcgccgcactccttgacgacg 704
||||| ||||||| ||||||| | |||| ||||||| |||||||||| ||| | ||
Sbjct: 648 ccggcaacgtcgancagggagcntataccctcgaagacgctgccgcactccctgatggcg 589
Query: 705 atgtccatga 714
||||||||||
Sbjct: 588 atgtccatga 579
Score = 40.1 bits (20), Expect = 0.17
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1183 caaaggatgtgtgccagagctctagctgagcgtcaagcaa 1222
||||||| ||||||||||||| |||||||| || |||||
Sbjct: 104 caaaggagatgtgccagagctcgagctgagcatcgagcaa 65
>gb|BG344915.2|BG344915 HVSMEg0016N12f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0016N12f, mRNA sequence
Length = 635
Score = 71.9 bits (36), Expect = 5e-011
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 1003 cgctgaagatgccggcggctgtgagcacccgcatgaggcgacgcaggcaggggatcttgg 1062
||||||||| ||||| | | |||||||| ||||| ||||| ||||||||| ||||||||
Sbjct: 285 cgctgaagacgccggagacagtgagcacacgcataaggcggcgcaggcagcagatcttgg 226
Query: 1063 acgggtggagcg 1074
||||||||||||
Sbjct: 225 acgggtggagcg 214
Score = 40.1 bits (20), Expect = 0.17
Identities = 33/38 (86%)
Strand = Plus / Minus
Query: 677 gaagacgtcgccgcactccttgacgacgatgtccatga 714
||||||| |||||||||| ||| | ||||||||||||
Sbjct: 617 gaagacgctgccgcactccntgatgncgatgtccatga 580
Score = 40.1 bits (20), Expect = 0.17
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 1183 caaaggatgtgtgccagagctctagctgagcgtcaagcaa 1222
||||||| ||||||||||||| |||||||| || |||||
Sbjct: 105 caaaggagatgtgccagagctcgagctgagcatcgagcaa 66
>gb|BI936373.1|BI936373 HVSMEa0019K09f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0019K09f, mRNA sequence
Length = 651
Score = 65.9 bits (33), Expect = 3e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 676 ggaagacgtcgccgcactccttgacgacgatgtccatgacgaagctgctgtcgcagacca 735
||||||| || |||||||| |||||| |||||||||||| ||||| |||||||||||||
Sbjct: 583 ggaagacctccccgcactctttgacgtcgatgtccatgatgaagcgcctgtcgcagacca 524
Query: 736 t 736
|
Sbjct: 523 t 523
>gb|BI957257.1|BI957257 HVSMEn0008H11f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0008H11f,
mRNA sequence
Length = 446
Score = 56.0 bits (28), Expect = 3e-006
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 1023 gtgagcacccgcatgaggcgacgcaggcaggggatcttggacgggtggagcg 1074
|||||||| ||||| ||| | ||||||||| ||||||||||||||||||||
Sbjct: 266 gtgagcacacgcataaggtggcgcaggcagcagatcttggacgggtggagcg 215
>gb|BF259471.1|BF259471 HVSMEf0019D06f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0019D06f, mRNA sequence
Length = 587
Score = 52.0 bits (26), Expect = 4e-005
Identities = 89/110 (80%)
Strand = Plus / Minus
Query: 375 acgattatcacctttcctcctgcatccctggaaggtatagctttcttacagttcttgagt 434
||||||||||| || || || ||||| |||| ||| ||||| | ||| || || || |||
Sbjct: 440 acgattatcactttcccaccagcatctctgggagggatagcctccttgcatttttttagt 381
Query: 435 atcttgatacaatcagcatcgccccagtcatgcaaaacccacttaaggaa 484
||||||| ||| || |||| ||||| ||||| ||||||||||| |||||
Sbjct: 380 atcttgacacagtcttcatcaccccaatcatggaaaacccacttcaggaa 331
>gb|BM817329.1|BM817329 HC105E06_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC105E06_T3.ab1 similar to Hexaprenyldihydroxybenzoate
methyltransferase,(S)-scoulerine 9-O-methyltransferase,
mRNA sequence
Length = 885
Score = 50.1 bits (25), Expect = 2e-004
Identities = 52/61 (85%)
Strand = Plus / Minus
Query: 465 tgcaaaacccacttaaggaagacggcgtctgccggtggaatgctctcaaacatgtcgcca 524
||||||| |||||| || | |||| |||||||||||| ||| ||||||||||||||||
Sbjct: 493 tgcaaaatccacttgagtagaacggtgtctgccggtgggatgtactcaaacatgtcgcca 434
Query: 525 g 525
|
Sbjct: 433 g 433
Score = 46.1 bits (23), Expect = 0.003
Identities = 53/63 (84%)
Strand = Plus / Minus
Query: 359 tccaacaaccatatcaacgattatcacctttcctcctgcatccctggaaggtatagcttt 418
|||||| |||||||| | |||||||||||| ||||| || ||||| | ||| || |||||
Sbjct: 599 tccaaccaccatatccatgattatcaccttccctcccgcgtcccttgcagggatggcttt 540
Query: 419 ctt 421
|||
Sbjct: 539 ctt 537
>gb|AL504432.1|AL504432 AL504432 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW05E10V 5', mRNA sequence
Length = 377
Score = 48.1 bits (24), Expect = 7e-004
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 573 gggagatccaggacactgcactggacatgcgggaacgcggtcg 615
||||| |||||||| ||||||| ||| ||||||||||| ||||
Sbjct: 248 gggaggtccaggacgctgcactcgacntgcgggaacgctgtcg 206
>gb|AV836790.1|AV836790 AV836790 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd3c22, mRNA
sequence
Length = 696
Score = 44.1 bits (22), Expect = 0.011
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 366 accatatcaacgattatcacctttcctcctgcatccct 403
|||||||| | |||||||||||||||||| || |||||
Sbjct: 277 accatatccatgattatcacctttcctccagcgtccct 314
>gb|AL508558.1|AL508558 AL508558 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY09B21V 5',
mRNA sequence
Length = 700
Score = 42.1 bits (21), Expect = 0.043
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 972 ccgccgccgtcgtccggcgag 992
|||||||||||||||||||||
Sbjct: 220 ccgccgccgtcgtccggcgag 200
>gb|BG300340.1|BG300340 HVSMEb0012K19f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0012K19f, mRNA sequence
Length = 512
Score = 42.1 bits (21), Expect = 0.043
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 972 ccgccgccgtcgtccggcgag 992
|||||||||||||||||||||
Sbjct: 269 ccgccgccgtcgtccggcgag 249
>gb|BQ471376.1|BQ471376 HV02E01r HV Hordeum vulgare subsp. vulgare cDNA clone HV02E01
5-PRIME, mRNA sequence
Length = 315
Score = 42.1 bits (21), Expect = 0.043
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 972 ccgccgccgtcgtccggcgag 992
|||||||||||||||||||||
Sbjct: 284 ccgccgccgtcgtccggcgag 264
>gb|BF621551.2|BF621551 HVSMEa0011G01f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0011G01f, mRNA sequence
Length = 789
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 183 tagacctcgatgatggatcg 202
||||||||||||||||||||
Sbjct: 412 tagacctcgatgatggatcg 393
>gb|BQ469638.1|BQ469638 HZ01G17r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ01G17
5-PRIME, mRNA sequence
Length = 465
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 985 ccggcgagcggtgggcggcg 1004
||||||||||||||||||||
Sbjct: 31 ccggcgagcggtgggcggcg 12
>gb|BQ469780.1|BQ469780 HZ01N15r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ01N15
5-PRIME, mRNA sequence
Length = 468
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 985 ccggcgagcggtgggcggcg 1004
||||||||||||||||||||
Sbjct: 31 ccggcgagcggtgggcggcg 12
>gb|CV064017.1|CV064017 BNEL96d7 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL96d7 5' similar to Unknown Function, mRNA
sequence
Length = 244
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 985 ccggcgagcggtgggcggcg 1004
||||||||||||||||||||
Sbjct: 177 ccggcgagcggtgggcggcg 158
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 165,074
Number of Sequences: 312970
Number of extensions: 165074
Number of successful extensions: 48095
Number of sequences better than 0.5: 25
Number of HSP's better than 0.5 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48024
Number of HSP's gapped (non-prelim): 69
length of query: 1228
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1209
effective length of database: 169,188,109
effective search space: 204548423781
effective search space used: 204548423781
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)