BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2188214.2.1
(880 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV911026.1|AV911026 AV911026 K. Sato unpublished cDNA li... 143 1e-032
gb|AV936335.1|AV936335 AV936335 K. Sato unpublished cDNA li... 129 2e-028
gb|BJ474523.1|BJ474523 BJ474523 K. Sato unpublished cDNA li... 129 2e-028
gb|CB880964.1|CB880964 HM08F20w HM Hordeum vulgare subsp. v... 129 2e-028
gb|CB882449.1|CB882449 HL01O07w HL Hordeum vulgare subsp. v... 129 2e-028
gb|CD663353.1|CD663353 UCRHV18_05ah10_b1 Drought-stressed D... 129 2e-028
gb|AV928420.1|AV928420 AV928420 K. Sato unpublished cDNA li... 127 7e-028
gb|BQ664207.1|BQ664207 HV02F10u HV Hordeum vulgare subsp. v... 127 7e-028
gb|CA010449.1|CA010449 HT09N07u HT Hordeum vulgare subsp. v... 127 7e-028
gb|BM097758.2|BM097758 EBem04_SQ002_J20_R embryo, 12 DPA, n... 101 4e-020
gb|BU975768.1|BU975768 HB32D23r BC Hordeum vulgare subsp. v... 92 4e-017
gb|AL505025.1|AL505025 AL505025 Hordeum vulgare Barke roots... 72 3e-011
gb|BF266054.2|BF266054 HV_CEa0014A22f Hordeum vulgare seedl... 42 0.030
gb|BE215525.2|BE215525 HV_CEb0008A19f Hordeum vulgare seedl... 42 0.030
gb|BE519725.2|BE519725 HV_CEb0018O04f Hordeum vulgare seedl... 42 0.030
gb|CA032687.1|CA032687 HX13O14r HX Hordeum vulgare subsp. v... 40 0.12
gb|BF627831.2|BF627831 HVSMEb0005O17f Hordeum vulgare seedl... 38 0.48
gb|BF617374.2|BF617374 HVSMEc0017A10f Hordeum vulgare seedl... 38 0.48
gb|BE194568.2|BE194568 HVSMEh0086A18f Hordeum vulgare 5-45 ... 38 0.48
gb|BE455046.2|BE455046 HVSMEh0095P16f Hordeum vulgare 5-45 ... 38 0.48
gb|BG367772.1|BG367772 HVSMEi0013J22f Hordeum vulgare 20 DA... 38 0.48
gb|BG368655.1|BG368655 HVSMEi0020C04f Hordeum vulgare 20 DA... 38 0.48
gb|BE602761.3|BE602761 HVSMEh0101I17f Hordeum vulgare 5-45 ... 38 0.48
gb|BG367761.2|BG367761 HVSMEi0013J03f Hordeum vulgare 20 DA... 38 0.48
gb|BM376594.2|BM376594 EBem05_SQ002_K16_R embryo, 14 DPA, n... 38 0.48
gb|BM377039.2|BM377039 EBem05_SQ003_P02_R embryo, 14 DPA, n... 38 0.48
gb|BM369391.2|BM369391 EBem07_SQ003_H06_R embryo, 28 DPA, n... 38 0.48
gb|BM368582.2|BM368582 EBem08_SQ004_A08_R embryo, 40 DPA, n... 38 0.48
gb|BM371243.2|BM371243 EBro04_SQ003_P12_R root, 3 week, sal... 38 0.48
gb|BQ759128.1|BQ759128 EBma07_SQ003_J23_R maternal, 21 DPA,... 38 0.48
gb|BQ764636.1|BQ764636 EBca01_SQ004_O09_R carpel, pre-anthe... 38 0.48
gb|BU994058.1|BU994058 HM05I22r HM Hordeum vulgare subsp. v... 38 0.48
gb|BU996314.1|BU996314 HM13D11r HM Hordeum vulgare subsp. v... 38 0.48
>gb|AV911026.1|AV911026 AV911026 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak11m03 3', mRNA sequence
Length = 685
Score = 143 bits (72), Expect = 1e-032
Identities = 183/220 (83%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
||||||||||||| ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 455 tacttcaaatctgccgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 514
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
|||||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 515 ggaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 574
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 575 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 634
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggca 793
|||| |||||||||||||| || |||||||| || |||||
Sbjct: 635 cacacaccgacttggagcagagcgggcatgcgaattggca 674
>gb|AV936335.1|AV936335 AV936335 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal10p08 3', mRNA sequence
Length = 678
Score = 129 bits (65), Expect = 2e-028
Identities = 211/262 (80%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 175 tacttcaaatttgccgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 234
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 235 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 294
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 295 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 354
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggcagtncncnnnnattnctttca 813
|||| |||||||||||||| || |||||||| || ||||| | | | ||| ||||||
Sbjct: 355 cacacaccgacttggagcagagcgggcatgcgaattggcaatgctccttcatttctttca 414
Query: 814 ggcactttacatgaatggtatg 835
||| ||| ||||||| |||||
Sbjct: 415 agcatttttcatgaattgtatg 436
>gb|BJ474523.1|BJ474523 BJ474523 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal14f22 3', mRNA sequence
Length = 389
Score = 129 bits (65), Expect = 2e-028
Identities = 181/220 (82%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 163 tacttcaaatttgncgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 222
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 223 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 282
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 283 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 342
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggca 793
|||| |||||||||||||| || |||||||| || |||||
Sbjct: 343 cacacaccgacttggagcagagcgggcatgctaattggca 382
>gb|CB880964.1|CB880964 HM08F20w HM Hordeum vulgare subsp. vulgare cDNA clone HM08F20
3-PRIME, mRNA sequence
Length = 663
Score = 129 bits (65), Expect = 2e-028
Identities = 211/262 (80%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 254 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 313
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 314 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 373
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 374 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 433
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggcagtncncnnnnattnctttca 813
|||| |||||||||||||| || |||||||| || ||||| | | | ||| ||||||
Sbjct: 434 cacacaccgacttggagcagagcgggcatgcgaattggcaatgctccttcatttctttca 493
Query: 814 ggcactttacatgaatggtatg 835
||| ||| ||||||| |||||
Sbjct: 494 agcatttttcatgaattgtatg 515
>gb|CB882449.1|CB882449 HL01O07w HL Hordeum vulgare subsp. vulgare cDNA clone HL01O07
3-PRIME, mRNA sequence
Length = 593
Score = 129 bits (65), Expect = 2e-028
Identities = 211/262 (80%)
Strand = Plus / Minus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 502 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 443
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 442 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 383
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 382 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 323
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggcagtncncnnnnattnctttca 813
|||| |||||||||||||| || |||||||| || ||||| | | | ||| ||||||
Sbjct: 322 cacacaccgacttggagcagagcgggcatgcgaattggcaatgctccttcatttctttca 263
Query: 814 ggcactttacatgaatggtatg 835
||| ||| ||||||| |||||
Sbjct: 262 agcatttttcatgaattgtatg 241
>gb|CD663353.1|CD663353 UCRHV18_05ah10_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_05ah10, mRNA sequence
Length = 706
Score = 129 bits (65), Expect = 2e-028
Identities = 211/262 (80%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 252 tacttcaaatttgccgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 311
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 312 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 371
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 372 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 431
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggcagtncncnnnnattnctttca 813
|||| |||||||||||||| || |||||||| || ||||| | | | ||| ||||||
Sbjct: 432 cacacaccgacttggagcagagcgggcatgcgaattggcaatgctccttcatttctttca 491
Query: 814 ggcactttacatgaatggtatg 835
||| ||| ||||||| |||||
Sbjct: 492 agcatttttcatgaattgtatg 513
>gb|AV928420.1|AV928420 AV928420 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basdg02 3', mRNA sequence
Length = 752
Score = 127 bits (64), Expect = 7e-028
Identities = 181/220 (82%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 503 tacttcaaatttgccgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 562
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 563 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 622
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 623 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 682
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggca 793
|||| |||||||||||||| || |||||||| || |||||
Sbjct: 683 cacacaccgacttggagcagagcgggcatgcgaattggca 722
>gb|BQ664207.1|BQ664207 HV02F10u HV Hordeum vulgare subsp. vulgare cDNA clone HV02F10
3-PRIME, mRNA sequence
Length = 497
Score = 127 bits (64), Expect = 7e-028
Identities = 181/220 (82%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 237 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 296
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 297 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 356
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 357 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 416
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggca 793
|||| |||||||||||||| || |||||||| || |||||
Sbjct: 417 cacacaccgacttggagcagagcgggcatgcgaattggca 456
>gb|CA010449.1|CA010449 HT09N07u HT Hordeum vulgare subsp. vulgare cDNA clone HT09N07
3-PRIME, mRNA sequence
Length = 488
Score = 127 bits (64), Expect = 7e-028
Identities = 181/220 (82%)
Strand = Plus / Plus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 233 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 292
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 293 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 352
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 353 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 412
Query: 754 cacaaaccgacttggagcaaagggggcatgcaaactggca 793
|||| |||||||||||||| || |||||||| || |||||
Sbjct: 413 cacacaccgacttggagcagagcgggcatgcgaattggca 452
>gb|BM097758.2|BM097758 EBem04_SQ002_J20_R embryo, 12 DPA, no treatment, cv Optic, EBem04
Hordeum vulgare subsp. vulgare cDNA clone
EBem04_SQ002_J20 5', mRNA sequence
Length = 424
Score = 101 bits (51), Expect = 4e-020
Identities = 156/191 (81%)
Strand = Plus / Minus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 191 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 132
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcggaccattttgtgat 693
| |||||||| ||||||| |||||||| || ||||| |||||||| ||||| || | |
Sbjct: 131 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcgaaccatcttatcgt 72
Query: 694 cacaggagtcagacagagttgccagctccatgtcgagcctttcccatgccttcgacatgt 753
| |||||| |||||||| || || || || || |||||||||||||| |||||||
Sbjct: 71 cgaaggagtttgacagagtcgctagttctgcatccagtctttcccatgcctttgacatgt 12
Query: 754 cacaaaccgac 764
|||| ||||||
Sbjct: 11 cacacaccgac 1
>gb|BU975768.1|BU975768 HB32D23r BC Hordeum vulgare subsp. vulgare cDNA clone HB32D23
5-PRIME, mRNA sequence
Length = 470
Score = 91.7 bits (46), Expect = 4e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 574 tacttcaaatctggcgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaat 633
|||||||||| || ||||||||||||||||||||| | |||||||| || ||||| || |
Sbjct: 321 tacttcaaatttgtcgggtgttgtatgacttgcaactatggcacttatgtgcaattaagt 262
Query: 634 ggaactgcacatctgatattgccccgcagtcgttgcataatatgcg 679
| |||||||| ||||||| |||||||| || ||||| ||||||||
Sbjct: 261 gaaactgcacctctgataccgccccgcaatcattgcacaatatgcg 216
Score = 58.0 bits (29), Expect = 5e-007
Identities = 35/37 (94%)
Strand = Plus / Minus
Query: 732 ctttcccatgccttcgacatgtcacaaaccgacttgg 768
|||||||||||||| ||||||||||| ||||||||||
Sbjct: 37 ctttcccatgcctttgacatgtcacacaccgacttgg 1
>gb|AL505025.1|AL505025 AL505025 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW07C11V 5', mRNA sequence
Length = 478
Score = 71.9 bits (36), Expect = 3e-011
Identities = 85/104 (81%)
Strand = Plus / Minus
Query: 732 ctttcccatgccttcgacatgtcacaaaccgacttggagcaaagggggcatgcaaactgg 791
|||||||||||||| |||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 439 ctttcccatgcctttnacatgtcacacaccgacttggagcagagcgggcatgcgaattgg 380
Query: 792 cagtncncnnnnattnctttcaggcactttacatgaatggtatg 835
|| | | | ||| |||||| ||| ||| ||||||| |||||
Sbjct: 379 caatgctccttcatttctttcaagcatttttcatgaattgtatg 336
>gb|BF266054.2|BF266054 HV_CEa0014A22f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0014A22f, mRNA sequence
Length = 543
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 227 gctcagcagccgccgccgccg 247
|||||||||||||||||||||
Sbjct: 72 gctcagcagccgccgccgccg 52
>gb|BE215525.2|BE215525 HV_CEb0008A19f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0008A19f, mRNA sequence
Length = 497
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 227 gctcagcagccgccgccgccg 247
|||||||||||||||||||||
Sbjct: 125 gctcagcagccgccgccgccg 105
>gb|BE519725.2|BE519725 HV_CEb0018O04f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0018O04f, mRNA sequence
Length = 512
Score = 42.1 bits (21), Expect = 0.030
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 227 gctcagcagccgccgccgccg 247
|||||||||||||||||||||
Sbjct: 118 gctcagcagccgccgccgccg 98
>gb|CA032687.1|CA032687 HX13O14r HX Hordeum vulgare subsp. vulgare cDNA clone HX13O14
5-PRIME, mRNA sequence
Length = 594
Score = 40.1 bits (20), Expect = 0.12
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 166 agctgcggcggcggcggcgc 185
||||||||||||||||||||
Sbjct: 198 agctgcggcggcggcggcgc 217
>gb|BF627831.2|BF627831 HVSMEb0005O17f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0005O17f, mRNA sequence
Length = 837
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 100 gctgcggcggcggcggcgc 82
>gb|BF617374.2|BF617374 HVSMEc0017A10f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0017A10f, mRNA sequence
Length = 764
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 114 gctgcggcggcggcggcgc 96
>gb|BE194568.2|BE194568 HVSMEh0086A18f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0086A18f, mRNA sequence
Length = 845
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 114 gctgcggcggcggcggcgc 96
>gb|BE455046.2|BE455046 HVSMEh0095P16f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0095P16f, mRNA sequence
Length = 587
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 113 gctgcggcggcggcggcgc 95
>gb|BG367772.1|BG367772 HVSMEi0013J22f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0013J22f, mRNA sequence
Length = 541
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 114 gctgcggcggcggcggcgc 96
>gb|BG368655.1|BG368655 HVSMEi0020C04f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0020C04f, mRNA sequence
Length = 503
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 102 gctgcggcggcggcggcgc 84
>gb|BE602761.3|BE602761 HVSMEh0101I17f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0101I17f, mRNA sequence
Length = 714
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 115 gctgcggcggcggcggcgc 97
>gb|BG367761.2|BG367761 HVSMEi0013J03f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0013J03f, mRNA sequence
Length = 552
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 114 gctgcggcggcggcggcgc 96
>gb|BM376594.2|BM376594 EBem05_SQ002_K16_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ002_K16 5', mRNA sequence
Length = 469
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 92 gctgcggcggcggcggcgc 74
>gb|BM377039.2|BM377039 EBem05_SQ003_P02_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ003_P02 5', mRNA sequence
Length = 485
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 108 gctgcggcggcggcggcgc 90
>gb|BM369391.2|BM369391 EBem07_SQ003_H06_R embryo, 28 DPA, no treatment, cv Optic, EBem07
Hordeum vulgare subsp. vulgare cDNA clone
EBem07_SQ003_H06 5', mRNA sequence
Length = 477
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 107 gctgcggcggcggcggcgc 89
>gb|BM368582.2|BM368582 EBem08_SQ004_A08_R embryo, 40 DPA, no treatment, cv Optic, EBem08
Hordeum vulgare subsp. vulgare cDNA clone
EBem08_SQ004_A08 5', mRNA sequence
Length = 374
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 105 gctgcggcggcggcggcgc 87
>gb|BM371243.2|BM371243 EBro04_SQ003_P12_R root, 3 week, salt-stressed, cv Optic, EBro04
Hordeum vulgare subsp. vulgare cDNA clone
EBro04_SQ003_P12 5', mRNA sequence
Length = 491
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 166 agctgcggcggcggcggcg 184
|||||||||||||||||||
Sbjct: 284 agctgcggcggcggcggcg 302
>gb|BQ759128.1|BQ759128 EBma07_SQ003_J23_R maternal, 21 DPA, no treatment, cv Optic, EBma07
Hordeum vulgare subsp. vulgare cDNA clone
EBma07_SQ003_J23 5', mRNA sequence
Length = 406
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 64 gctgcggcggcggcggcgc 46
>gb|BQ764636.1|BQ764636 EBca01_SQ004_O09_R carpel, pre-anthesis, no treatment, cv Optic,
EBca01 Hordeum vulgare subsp. vulgare cDNA clone
EBca01_SQ004_O09 5', mRNA sequence
Length = 598
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 167 gctgcggcggcggcggcgc 185
|||||||||||||||||||
Sbjct: 104 gctgcggcggcggcggcgc 86
>gb|BU994058.1|BU994058 HM05I22r HM Hordeum vulgare subsp. vulgare cDNA clone HM05I22
5-PRIME, mRNA sequence
Length = 655
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 170 gcggcggcggcggcgcact 188
|||||||||||||||||||
Sbjct: 250 gcggcggcggcggcgcact 232
>gb|BU996314.1|BU996314 HM13D11r HM Hordeum vulgare subsp. vulgare cDNA clone HM13D11
5-PRIME, mRNA sequence
Length = 611
Score = 38.2 bits (19), Expect = 0.48
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 170 gcggcggcggcggcgcact 188
|||||||||||||||||||
Sbjct: 557 gcggcggcggcggcgcact 575
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 195,530
Number of Sequences: 312970
Number of extensions: 195530
Number of successful extensions: 100115
Number of sequences better than 0.5: 33
Number of HSP's better than 0.5 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99993
Number of HSP's gapped (non-prelim): 90
length of query: 880
length of database: 175,134,539
effective HSP length: 19
effective length of query: 861
effective length of database: 169,188,109
effective search space: 145670961849
effective search space used: 145670961849
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)