BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 131537.2.355
         (842 letters)

Database: Hordeum_nucl_with_EST.fasta 
           312,970 sequences; 175,134,539 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BM376670.2|BM376670  EBem05_SQ002_O03_R embryo, 14 DPA, n...   486   e-136
gb|BM375871.2|BM375871  EBem06_SQ004_K11_R embryo, 21 DPA, n...   486   e-136
gb|BM374033.2|BM374033  EBma03_SQ003_H07_R maternal, 8 DPA, ...   486   e-136
gb|BU978977.1|BU978977  HA14M24r HA Hordeum vulgare subsp. v...   486   e-136
gb|BU982853.1|BU982853  HA27M23r HA Hordeum vulgare subsp. v...   486   e-136
gb|CA031769.1|CA031769  HX11B09r HX Hordeum vulgare subsp. v...   486   e-136
gb|CK123061.1|CK123061  BES1824101p23 BES1824 Hordeum vulgar...   486   e-136
gb|AL507937.1|AL507937  AL507937 Hordeum vulgare Barke devel...   480   e-134
gb|BQ459604.1|BQ459604  HA08K08r HA Hordeum vulgare subsp. v...   480   e-134
gb|BU976197.1|BU976197  HA03F02r HA Hordeum vulgare subsp. v...   480   e-134
gb|BU978624.1|BU978624  HA13M12r HA Hordeum vulgare subsp. v...   480   e-134
gb|BU983681.1|BU983681  HA30K05r HA Hordeum vulgare subsp. v...   480   e-134
gb|CA024661.1|CA024661  HZ49P02r HZ Hordeum vulgare subsp. v...   480   e-134
gb|CA028149.1|CA028149  HZ61C08r HZ Hordeum vulgare subsp. v...   480   e-134
gb|CB883569.1|CB883569  HQ02K12w HQ Hordeum vulgare subsp. v...   480   e-134
gb|CV053818.1|CV053818  BNEL103e4 Barley EST endosperm libra...   480   e-134
gb|CV056345.1|CV056345  BNEL16F6 Barley EST endosperm librar...   480   e-134
gb|CV061361.1|CV061361  BNEL67h8 Barley EST endosperm librar...   480   e-134
gb|CV063444.1|CV063444  BNEL8D2 Barley EST endosperm library...   480   e-134
gb|CK122911.1|CK122911  BES1824101d03 BES1824 Hordeum vulgar...   480   e-134
gb|CK124134.1|CK124134  BES1824107c19 BES1824 Hordeum vulgar...   480   e-134
gb|CK124193.1|CK124193  BES1824107f18 BES1824 Hordeum vulgar...   480   e-134
gb|CK124884.1|CK124884  BES1824110o17 BES1824 Hordeum vulgar...   480   e-134
gb|BJ464995.1|BJ464995  BJ464995 K. Sato unpublished cDNA li...   476   e-133
gb|CB876373.1|CB876373  HX11B09w HX Hordeum vulgare subsp. v...   476   e-133
gb|CA014353.1|CA014353  HT11B21r HT Hordeum vulgare subsp. v...   474   e-132
gb|BF254096.3|BF254096  HVSMEf0003A06f Hordeum vulgare seedl...   472   e-132
gb|BM097641.2|BM097641  EBem04_SQ002_E17_R embryo, 12 DPA, n...   472   e-132
gb|BM100628.2|BM100628  EBma01_SQ005_M10_R maternal, 4 DPA, ...   472   e-132
gb|BI778732.2|BI778732  EBro01_SQ001_E06_R root, 3 week, hyd...   472   e-132
gb|BQ759749.1|BQ759749  EBpi05_SQ004_D11_R pistil, 8 DPA, no...   472   e-132
gb|BQ767014.1|BQ767014  EBro08_SQ007_B19_R root, 3 week, dro...   472   e-132
gb|BQ458920.1|BQ458920  HA02N15r HA Hordeum vulgare subsp. v...   466   e-130
gb|BQ657190.1|BQ657190  HA09E24u HA Hordeum vulgare subsp. v...   466   e-130
gb|BM097856.2|BM097856  EBem04_SQ002_O11_R embryo, 12 DPA, n...   466   e-130
gb|BM377645.2|BM377645  EBem04_SQ003_M03_R embryo, 12 DPA, n...   466   e-130
gb|BQ768768.1|BQ768768  EBro08_SQ012_M13_R root, 3 week, dro...   466   e-130
gb|BU977854.1|BU977854  HA12C14r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU978804.1|BU978804  HA14F04r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU979516.1|BU979516  HA16G16r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU979612.1|BU979612  HA16L11r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU979716.1|BU979716  HA17A16r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU980231.1|BU980231  HA20B03r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU981929.1|BU981929  HA25A12r HA Hordeum vulgare subsp. v...   466   e-130
gb|BU983269.1|BU983269  HA29C08r HA Hordeum vulgare subsp. v...   466   e-130
gb|CA012215.1|CA012215  HT04M17r HT Hordeum vulgare subsp. v...   466   e-130
gb|CA018589.1|CA018589  HV09B05r HV Hordeum vulgare subsp. v...   466   e-130
gb|CA028621.1|CA028621  HZ62K14r HZ Hordeum vulgare subsp. v...   466   e-130
gb|CA031561.1|CA031561  HX10G09r HX Hordeum vulgare subsp. v...   466   e-130
gb|CA032140.1|CA032140  HX12C05r HX Hordeum vulgare subsp. v...   466   e-130
gb|CA032241.1|CA032241  HX12H04r HX Hordeum vulgare subsp. v...   466   e-130
gb|CB876207.1|CB876207  HX10J16w HX Hordeum vulgare subsp. v...   466   e-130
gb|CK122016.1|CK122016  BES1824101a01 BES1824 Hordeum vulgar...   466   e-130
gb|CK124222.1|CK124222  BES1824108a13 BES1824 Hordeum vulgar...   466   e-130
gb|CK125189.1|CK125189  BES1824106p12 BES1824 Hordeum vulgar...   466   e-130
gb|BJ464563.1|BJ464563  BJ464563 K. Sato unpublished cDNA li...   464   e-129
gb|BJ464912.1|BJ464912  BJ464912 K. Sato unpublished cDNA li...   464   e-129
gb|BJ466914.1|BJ466914  BJ466914 K. Sato unpublished cDNA li...   464   e-129
gb|BI780644.2|BI780644  EBes01_SQ001_J19_R embryo sac, 4-6 D...   464   e-129
gb|CV056586.1|CV056586  BNEL19D6 Barley EST endosperm librar...   464   e-129
gb|BG418559.2|BG418559  HVSMEk0023C06f Hordeum vulgare testa...   462   e-129
gb|BM099812.2|BM099812  EBes01_SQ004_F15_R embryo sac, 4-6 D...   458   e-127
gb|BI777807.2|BI777807  EBro08_SQ002_C08_R root, 3 week, dro...   458   e-127
gb|CA018186.1|CA018186  HV07O01r HV Hordeum vulgare subsp. v...   458   e-127
gb|BF627236.3|BF627236  HVSMEb0004F01f Hordeum vulgare seedl...   456   e-127
gb|BG343707.2|BG343707  HVSMEg0006I11f Hordeum vulgare pre-a...   456   e-127
gb|BG344491.2|BG344491  HVSMEg0009G20f Hordeum vulgare pre-a...   456   e-127
gb|AV919881.1|AV919881  AV919881 K. Sato unpublished cDNA li...   456   e-127
gb|BQ470411.1|BQ470411  HX02O12r HX Hordeum vulgare subsp. v...   456   e-127
gb|BQ470518.1|BQ470518  HX03D15r HX Hordeum vulgare subsp. v...   456   e-127
gb|BM377599.2|BM377599  EBem04_SQ003_K01_R embryo, 12 DPA, n...   456   e-127
gb|BM375013.2|BM375013  EBem06_SQ002_B10_R embryo, 21 DPA, n...   456   e-127
gb|BM097367.2|BM097367  EBro01_SQ004_O21_R root, 3 week, hyd...   456   e-127
gb|BM370921.2|BM370921  EBro04_SQ002_N13_R root, 3 week, sal...   456   e-127
gb|BQ754233.1|BQ754233  EBca01_SQ003_E10_R carpel, pre-anthe...   456   e-127
gb|BU968806.1|BU968806  HB08K09r BC Hordeum vulgare subsp. v...   456   e-127
gb|BU979604.1|BU979604  HA16L03r HA Hordeum vulgare subsp. v...   456   e-127
gb|BU981167.1|BU981167  HA22N07r HA Hordeum vulgare subsp. v...   456   e-127
gb|BU981798.1|BU981798  HA24K18r HA Hordeum vulgare subsp. v...   456   e-127
gb|BU983259.1|BU983259  HA29B15r HA Hordeum vulgare subsp. v...   456   e-127
gb|BU984036.1|BU984036  HA31M20r HA Hordeum vulgare subsp. v...   456   e-127
gb|BU986905.1|BU986905  HF13E01r HF Hordeum vulgare subsp. v...   456   e-127
gb|BU987546.1|BU987546  HF15A19r HF Hordeum vulgare subsp. v...   456   e-127
gb|BU989068.1|BU989068  HF19K19r HF Hordeum vulgare subsp. v...   456   e-127
gb|CA030399.1|CA030399  HX06P04r HX Hordeum vulgare subsp. v...   456   e-127
gb|CK122020.1|CK122020  BES1824101a07 BES1824 Hordeum vulgar...   456   e-127
gb|CK122585.1|CK122585  BES1824104h23 BES1824 Hordeum vulgar...   456   e-127
gb|CK123782.1|CK123782  BES1824105f13 BES1824 Hordeum vulgar...   456   e-127
gb|BQ764505.1|BQ764505  EBca01_SQ004_G01_R carpel, pre-anthe...   454   e-126
gb|BU997989.1|BU997989  HI09K04r HI Hordeum vulgare subsp. v...   454   e-126
gb|CA002184.1|CA002184  HS06M08r HS Hordeum vulgare subsp. v...   454   e-126
gb|BG416688.1|BG416688  HVSMEk0014C02f Hordeum vulgare testa...   452   e-126
gb|AW983365.3|AW983365  HVSMEg0010F21f Hordeum vulgare pre-a...   452   e-126
gb|CA030671.1|CA030671  HX07M09r HX Hordeum vulgare subsp. v...   450   e-125
gb|BG343596.2|BG343596  HVSMEg0006H20f Hordeum vulgare pre-a...   448   e-124
gb|AV915405.1|AV915405  AV915405 K. Sato unpublished cDNA li...   448   e-124
gb|AV917275.1|AV917275  AV917275 K. Sato unpublished cDNA li...   448   e-124
gb|AV919174.1|AV919174  AV919174 K. Sato unpublished cDNA li...   448   e-124
gb|AV920492.1|AV920492  AV920492 K. Sato unpublished cDNA li...   448   e-124
gb|AV921933.1|AV921933  AV921933 K. Sato unpublished cDNA li...   448   e-124
gb|AV922446.1|AV922446  AV922446 K. Sato unpublished cDNA li...   448   e-124
gb|BJ466256.1|BJ466256  BJ466256 K. Sato unpublished cDNA li...   448   e-124
gb|AV914316.1|AV914316  AV914316 K. Sato unpublished cDNA li...   446   e-124
gb|AV916643.1|AV916643  AV916643 K. Sato unpublished cDNA li...   446   e-124
gb|AV919343.1|AV919343  AV919343 K. Sato unpublished cDNA li...   446   e-124
gb|BQ458678.1|BQ458678  HA04I09r HA Hordeum vulgare subsp. v...   446   e-124
gb|BQ459572.1|BQ459572  HA08L16r HA Hordeum vulgare subsp. v...   446   e-124
gb|BQ459876.1|BQ459876  HA07N08r HA Hordeum vulgare subsp. v...   446   e-124
gb|BQ460655.1|BQ460655  HA06E24r HA Hordeum vulgare subsp. v...   446   e-124
gb|BQ656426.1|BQ656426  HA04I09u HA Hordeum vulgare subsp. v...   446   e-124
gb|BM375051.2|BM375051  EBem06_SQ002_D02_R embryo, 21 DPA, n...   446   e-124
gb|BM373234.2|BM373234  EBma04_SQ003_K07_R maternal, 10 DPA,...   446   e-124
gb|BM371448.2|BM371448  EBma08_SQ002_M08_R maternal, 28 DPA,...   446   e-124
gb|BM100839.2|BM100839  EBpi01_SQ002_C09_R pistil, 1 DPA, no...   446   e-124
gb|BM101033.2|BM101033  EBpi01_SQ002_K10_R pistil, 1 DPA, no...   446   e-124
gb|BU981814.1|BU981814  HA24L12r HA Hordeum vulgare subsp. v...   446   e-124
gb|CA012538.1|CA012538  HT05L10r HT Hordeum vulgare subsp. v...   446   e-124
gb|CA013768.1|CA013768  HT09G21r HT Hordeum vulgare subsp. v...   446   e-124
gb|CV064263.1|CV064263  BNEL99h8 Barley EST endosperm librar...   446   e-124
gb|CK124486.1|CK124486  BES1824109f12 BES1824 Hordeum vulgar...   446   e-124
gb|AL506944.1|AL506944  AL506944 Hordeum vulgare Barke devel...   444   e-123
gb|BI953670.1|BI953670  HVSMEm0013M20f Hordeum vulgare green...   444   e-123
gb|BG416096.2|BG416096  HVSMEk0009L21f Hordeum vulgare testa...   444   e-123
gb|AV916514.1|AV916514  AV916514 K. Sato unpublished cDNA li...   444   e-123
gb|AV918040.1|AV918040  AV918040 K. Sato unpublished cDNA li...   444   e-123
gb|AV930746.1|AV930746  AV930746 K. Sato unpublished cDNA li...   444   e-123
gb|BM373265.2|BM373265  EBma04_SQ003_M09_R maternal, 10 DPA,...   444   e-123
gb|BU967063.1|BU967063  HB03C22r BC Hordeum vulgare subsp. v...   444   e-123
gb|AL507569.1|AL507569  AL507569 Hordeum vulgare Barke devel...   442   e-123
gb|AL510857.1|AL510857  AL510857 Hordeum vulgare Barke devel...   442   e-123
gb|BF254574.3|BF254574  HVSMEf0004G12f Hordeum vulgare seedl...   442   e-123
gb|AW983325.3|AW983325  HVSMEg0010D14f Hordeum vulgare pre-a...   442   e-123
gb|AV912739.1|AV912739  AV912739 K. Sato unpublished cDNA li...   442   e-123
gb|AV917474.1|AV917474  AV917474 K. Sato unpublished cDNA li...   442   e-123
gb|BJ462748.1|BJ462748  BJ462748 K. Sato unpublished cDNA li...   442   e-123
gb|BJ465577.1|BJ465577  BJ465577 K. Sato unpublished cDNA li...   442   e-123
gb|BJ467420.1|BJ467420  BJ467420 K. Sato unpublished cDNA li...   442   e-123
gb|BQ459084.1|BQ459084  HA02G02r HA Hordeum vulgare subsp. v...   442   e-123
gb|BM376971.2|BM376971  EBem05_SQ003_M01_R embryo, 14 DPA, n...   442   e-123
gb|BQ754531.1|BQ754531  EBed01_SQ003_B01_R endosperm, 6 DPA,...   442   e-123
gb|BU977304.1|BU977304  HA11D04r HA Hordeum vulgare subsp. v...   442   e-123
gb|BU981849.1|BU981849  HA24N02r HA Hordeum vulgare subsp. v...   442   e-123
gb|BU983258.1|BU983258  HA29B12r HA Hordeum vulgare subsp. v...   442   e-123
gb|CA000847.1|CA000847  HS06M08u HS Hordeum vulgare subsp. v...   442   e-123
gb|CA005826.1|CA005826  HU08D11u HU Hordeum vulgare subsp. v...   442   e-123
gb|CA022945.1|CA022945  HZ44M21r HZ Hordeum vulgare subsp. v...   442   e-123
gb|CA029421.1|CA029421  HZ65C16r HZ Hordeum vulgare subsp. v...   442   e-123
gb|CB883155.1|CB883155  HQ01G02w HQ Hordeum vulgare subsp. v...   442   e-123
gb|CK124493.1|CK124493  BES1824109f20 BES1824 Hordeum vulgar...   442   e-123
gb|CK125415.1|CK125415  BES1824107p02 BES1824 Hordeum vulgar...   442   e-123
gb|AL505071.1|AL505071  AL505071 Hordeum vulgare Barke roots...   440   e-122
gb|BJ467308.1|BJ467308  BJ467308 K. Sato unpublished cDNA li...   440   e-122
gb|BM375868.2|BM375868  EBem06_SQ004_K08_R embryo, 21 DPA, n...   440   e-122
gb|CK122242.1|CK122242  BES1824102i08 BES1824 Hordeum vulgar...   440   e-122
gb|CK124210.1|CK124210  BES1824108a01 BES1824 Hordeum vulgar...   440   e-122
gb|CK125912.1|CK125912  BES1824111B1g03 BES1824 Hordeum vulg...   440   e-122
gb|BU980120.1|BU980120  HA18K22r HA Hordeum vulgare subsp. v...   438   e-121
gb|BG343775.2|BG343775  HVSMEg0006L13f Hordeum vulgare pre-a...   436   e-121
gb|BM099405.2|BM099405  EBes01_SQ003_C13_R embryo sac, 4-6 D...   436   e-121
gb|BI779646.2|BI779646  EBro01_SQ004_K18_R root, 3 week, hyd...   436   e-121
gb|BQ764066.1|BQ764066  EBro03_SQ006_N04_R root, 3 week, wat...   436   e-121
gb|BU979414.1|BU979414  HA16B08r HA Hordeum vulgare subsp. v...   436   e-121
gb|BU979805.1|BU979805  HA17G07r HA Hordeum vulgare subsp. v...   436   e-121
gb|BQ755113.1|BQ755113  EBed02_SQ003_M05_R endosperm, 8 DPA,...   434   e-120
gb|BU978206.1|BU978206  HA12M02r HA Hordeum vulgare subsp. v...   434   e-120
gb|BF630505.3|BF630505  HVSMEb0010K21f Hordeum vulgare seedl...   432   e-120
gb|AJ435888.1|AJ435888  AJ435888 S00002 Hordeum vulgare subs...   432   e-120
gb|BI776369.2|BI776369  EBpi05_SQ001_A06_R pistil, 8 DPA, no...   432   e-120
gb|BQ764957.1|BQ764957  EBca01_SQ005_J11_R carpel, pre-anthe...   432   e-120
gb|CK122978.1|CK122978  BES1824101k04 BES1824 Hordeum vulgar...   432   e-120
gb|BG416589.1|BG416589  HVSMEk0013E08f Hordeum vulgare testa...   430   e-119
gb|BE193550.3|BE193550  HVSMEh0081I24f Hordeum vulgare 5-45 ...   430   e-119
gb|AV924522.1|AV924522  AV924522 K. Sato unpublished cDNA li...   430   e-119
gb|AV929614.1|AV929614  AV929614 K. Sato unpublished cDNA li...   430   e-119
gb|BQ459109.1|BQ459109  HA02E09r HA Hordeum vulgare subsp. v...   430   e-119
gb|BQ470600.1|BQ470600  HX03H10r HX Hordeum vulgare subsp. v...   430   e-119
gb|BQ470850.1|BQ470850  HX04D15r HX Hordeum vulgare subsp. v...   430   e-119
gb|BQ656566.1|BQ656566  HA04A14u HA Hordeum vulgare subsp. v...   430   e-119
gb|BM368166.2|BM368166  EBed01_SQ002_F19_R endosperm, 6 DPA,...   430   e-119
gb|BI776358.2|BI776358  EBem04_SQ001_N03_R embryo, 12 DPA, n...   430   e-119
gb|BM097763.2|BM097763  EBem04_SQ002_K02_R embryo, 12 DPA, n...   430   e-119
gb|BM098856.2|BM098856  EBpi05_SQ002_E06_R pistil, 8 DPA, no...   430   e-119
gb|BQ754295.1|BQ754295  EBca01_SQ003_H15_R carpel, pre-anthe...   430   e-119
gb|BQ760683.1|BQ760683  EBro03_SQ003_C24_R root, 3 week, wat...   430   e-119
gb|BQ764686.1|BQ764686  EBca01_SQ004_I14_R carpel, pre-anthe...   430   e-119
gb|BU976315.1|BU976315  HA03I03r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU976316.1|BU976316  HA03I03u HA Hordeum vulgare subsp. v...   430   e-119
gb|BU981034.1|BU981034  HA22H03r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU982625.1|BU982625  HA27B22r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU983277.1|BU983277  HA29C16r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU983310.1|BU983310  HA29E12r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU983330.1|BU983330  HA29G01r HA Hordeum vulgare subsp. v...   430   e-119
gb|BU997379.1|BU997379  HI07M23r HI Hordeum vulgare subsp. v...   430   e-119
gb|CA018550.1|CA018550  HV08P05r HV Hordeum vulgare subsp. v...   430   e-119
gb|CA022981.1|CA022981  HZ44O12r HZ Hordeum vulgare subsp. v...   430   e-119
gb|CA023153.1|CA023153  HZ45G05r HZ Hordeum vulgare subsp. v...   430   e-119
gb|CA024093.1|CA024093  HZ48F12r HZ Hordeum vulgare subsp. v...   430   e-119
gb|CA029767.1|CA029767  HX05C14r HX Hordeum vulgare subsp. v...   430   e-119
gb|CA032407.1|CA032407  HX12P03r HX Hordeum vulgare subsp. v...   430   e-119
gb|CB874401.1|CB874401  HX05C14w HX Hordeum vulgare subsp. v...   430   e-119
gb|CB874991.1|CB874991  HX06P04w HX Hordeum vulgare subsp. v...   430   e-119
gb|CB875265.1|CB875265  HX07M09w HX Hordeum vulgare subsp. v...   430   e-119
gb|CK122982.1|CK122982  BES1824101k09 BES1824 Hordeum vulgar...   430   e-119
gb|BE196238.2|BE196238  HVSMEh0091L22f Hordeum vulgare 5-45 ...   428   e-118
gb|BE455138.2|BE455138  HVSMEh0096F12f Hordeum vulgare 5-45 ...   428   e-118
gb|BI947588.1|BI947588  HVSMEl0006A05f Hordeum vulgare spike...   428   e-118
gb|BI948327.1|BI948327  HVSMEl0009A20f Hordeum vulgare spike...   428   e-118
gb|BF628488.3|BF628488  HVSMEb0006E02f Hordeum vulgare seedl...   428   e-118
gb|BG343408.2|BG343408  HVSMEg0005K20f Hordeum vulgare pre-a...   428   e-118
gb|BG418228.2|BG418228  HVSMEk0021P20f Hordeum vulgare testa...   428   e-118
gb|AV917222.1|AV917222  AV917222 K. Sato unpublished cDNA li...   428   e-118
gb|AV918558.1|AV918558  AV918558 K. Sato unpublished cDNA li...   428   e-118
gb|AV922389.1|AV922389  AV922389 K. Sato unpublished cDNA li...   428   e-118
gb|BJ466929.1|BJ466929  BJ466929 K. Sato unpublished cDNA li...   428   e-118
gb|BQ458323.1|BQ458323  HA05I21r HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ459823.1|BQ459823  HA07P18r HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ459827.1|BQ459827  HA07P10r HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ460241.1|BQ460241  HA06N13r HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ471248.1|BQ471248  HV01N05T HV Hordeum vulgare subsp. v...   428   e-118
gb|BQ657275.1|BQ657275  HA08P19u HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ657367.1|BQ657367  HA08K08u HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ657532.1|BQ657532  HA07P18u HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ657539.1|BQ657539  HA07P10u HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ658137.1|BQ658137  HA05I21u HA Hordeum vulgare subsp. v...   428   e-118
gb|BQ664103.1|BQ664103  HV01N05w HV Hordeum vulgare subsp. v...   428   e-118
gb|BM097585.2|BM097585  EBem04_SQ002_C02_R embryo, 12 DPA, n...   428   e-118
gb|BM374169.2|BM374169  EBma03_SQ003_N14_R maternal, 8 DPA, ...   428   e-118
gb|BM098078.2|BM098078  EBpi03_SQ002_H22_R pistil, 4 DPA, no...   428   e-118
gb|BU976198.1|BU976198  HA03F02u HA Hordeum vulgare subsp. v...   428   e-118
gb|BU976748.1|BU976748  HA10D19r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU976749.1|BU976749  HA10D19u HA Hordeum vulgare subsp. v...   428   e-118
gb|BU976788.1|BU976788  HA10F02r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU976789.1|BU976789  HA10F02u HA Hordeum vulgare subsp. v...   428   e-118
gb|BU980664.1|BU980664  HA21F06r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU980695.1|BU980695  HA21G17r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU982257.1|BU982257  HA25P17r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU982790.1|BU982790  HA27J22r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU983143.1|BU983143  HA28L04r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU983503.1|BU983503  HA29P06r HA Hordeum vulgare subsp. v...   428   e-118
gb|BU990545.1|BU990545  HF25F23r HF Hordeum vulgare subsp. v...   428   e-118
gb|BU994835.1|BU994835  HM08F18r HM Hordeum vulgare subsp. v...   428   e-118
gb|BU997068.1|BU997068  HI06M24r HI Hordeum vulgare subsp. v...   428   e-118
gb|CA020496.1|CA020496  HZ36H20r HZ Hordeum vulgare subsp. v...   428   e-118
gb|CA020546.1|CA020546  HZ36K04r HZ Hordeum vulgare subsp. v...   428   e-118
gb|CA026426.1|CA026426  HZ55O04r HZ Hordeum vulgare subsp. v...   428   e-118
gb|CA027857.1|CA027857  HZ60D23r HZ Hordeum vulgare subsp. v...   428   e-118
gb|CA029446.1|CA029446  HZ65D21r HZ Hordeum vulgare subsp. v...   428   e-118
gb|CA032038.1|CA032038  HX11N07r HX Hordeum vulgare subsp. v...   428   e-118
gb|CA032781.1|CA032781  HX14D01r HX Hordeum vulgare subsp. v...   428   e-118
gb|CA032926.1|CA032926  HX14J17r HX Hordeum vulgare subsp. v...   428   e-118
gb|CB858383.1|CB858383  HI06M24w HI Hordeum vulgare subsp. v...   428   e-118
gb|CB876616.1|CB876616  HX11N07w HX Hordeum vulgare subsp. v...   428   e-118
gb|CB880962.1|CB880962  HM08F18w HM Hordeum vulgare subsp. v...   428   e-118
gb|CK122018.1|CK122018  BES1824101a04 BES1824 Hordeum vulgar...   428   e-118
gb|CK122360.1|CK122360  BES1824103a02 BES1824 Hordeum vulgar...   428   e-118
gb|CK122845.1|CK122845  BES1824106c24 BES1824 Hordeum vulgar...   428   e-118
gb|CK122974.1|CK122974  BES1824101j23 BES1824 Hordeum vulgar...   428   e-118
gb|CK123107.1|CK123107  BES1824102b23 BES1824 Hordeum vulgar...   428   e-118
gb|CK123695.1|CK123695  BES1824105b21 BES1824 Hordeum vulgar...   428   e-118
gb|CK125773.1|CK125773  BES1824110m05 BES1824 Hordeum vulgar...   428   e-118
gb|AL506541.1|AL506541  AL506541 Hordeum vulgare Barke devel...   426   e-118
gb|AL508344.1|AL508344  AL508344 Hordeum vulgare Barke devel...   426   e-118
gb|BI950640.1|BI950640  HVSMEl0021N20f Hordeum vulgare spike...   426   e-118
gb|BF258396.3|BF258396  HVSMEf0015J20f Hordeum vulgare seedl...   426   e-118
gb|AV913264.1|AV913264  AV913264 K. Sato unpublished cDNA li...   426   e-118
gb|AJ462183.1|AJ462183  AJ462183 S00002 Hordeum vulgare subs...   426   e-118
gb|BJ466209.1|BJ466209  BJ466209 K. Sato unpublished cDNA li...   426   e-118
gb|BQ460424.1|BQ460424  HA09L01r HA Hordeum vulgare subsp. v...   426   e-118
gb|BQ470847.1|BQ470847  HX04D12r HX Hordeum vulgare subsp. v...   426   e-118
gb|BQ471006.1|BQ471006  HX04L02r HX Hordeum vulgare subsp. v...   426   e-118
gb|BQ472067.1|BQ472067  HV04F01r HV Hordeum vulgare subsp. v...   426   e-118
gb|BQ664866.1|BQ664866  HX01C21w HX Hordeum vulgare subsp. v...   426   e-118
gb|BM097850.2|BM097850  EBem04_SQ002_O03_R embryo, 12 DPA, n...   426   e-118
gb|BM377820.2|BM377820  EBem04_SQ004_E12_R embryo, 12 DPA, n...   426   e-118
gb|BM377906.2|BM377906  EBem04_SQ004_I18_R embryo, 12 DPA, n...   426   e-118
gb|BM376758.2|BM376758  EBem05_SQ003_C12_R embryo, 14 DPA, n...   426   e-118
gb|BI780639.2|BI780639  EBes01_SQ001_J08_R embryo sac, 4-6 D...   426   e-118
gb|BM101469.2|BM101469  EBpi01_SQ003_P03_R pistil, 1 DPA, no...   426   e-118
gb|BM370933.2|BM370933  EBro04_SQ002_O10_R root, 3 week, sal...   426   e-118
gb|BM370960.2|BM370960  EBro04_SQ003_A21_R root, 3 week, sal...   426   e-118
gb|BQ767796.1|BQ767796  EBro08_SQ009_J20_R root, 3 week, dro...   426   e-118
gb|BQ768784.1|BQ768784  EBro08_SQ012_K15_R root, 3 week, dro...   426   e-118
gb|BU976733.1|BU976733  HA10D09r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU977521.1|BU977521  HA11J02r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU980042.1|BU980042  HA18F23r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU980079.1|BU980079  HA18H13r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU980167.1|BU980167  HA18O02r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU980421.1|BU980421  HA20J18r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU981505.1|BU981505  HA23N09r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU984017.1|BU984017  HA31L21r HA Hordeum vulgare subsp. v...   426   e-118
gb|BU984322.1|BU984322  HF03J20r HF Hordeum vulgare subsp. v...   426   e-118
gb|BU984750.1|BU984750  HF04O11r HF Hordeum vulgare subsp. v...   426   e-118
gb|BU985218.1|BU985218  HF06H22r HF Hordeum vulgare subsp. v...   426   e-118
gb|BU998919.1|BU998919  HI12J03r HI Hordeum vulgare subsp. v...   426   e-118
gb|BU999705.1|BU999705  HI15H01r HI Hordeum vulgare subsp. v...   426   e-118
gb|CA016652.1|CA016652  HV08C22u HV Hordeum vulgare subsp. v...   426   e-118
gb|CA018287.1|CA018287  HV08C22r HV Hordeum vulgare subsp. v...   426   e-118
gb|CA022379.1|CA022379  HZ42P03r HZ Hordeum vulgare subsp. v...   426   e-118
gb|CA029923.1|CA029923  HX05J11r HX Hordeum vulgare subsp. v...   426   e-118
gb|CA030835.1|CA030835  HX08E10r HX Hordeum vulgare subsp. v...   426   e-118
gb|CA030944.1|CA030944  HX08J09r HX Hordeum vulgare subsp. v...   426   e-118
gb|CA031816.1|CA031816  HX11D11r HX Hordeum vulgare subsp. v...   426   e-118
gb|CA032385.1|CA032385  HX12O02r HX Hordeum vulgare subsp. v...   426   e-118
gb|CA032933.1|CA032933  HX14K02r HX Hordeum vulgare subsp. v...   426   e-118
gb|CB860078.1|CB860078  HI12J03w HI Hordeum vulgare subsp. v...   426   e-118
gb|CB874544.1|CB874544  HX05J11w HX Hordeum vulgare subsp. v...   426   e-118
gb|CB875427.1|CB875427  HX08E10w HX Hordeum vulgare subsp. v...   426   e-118
gb|CB875527.1|CB875527  HX08J09w HX Hordeum vulgare subsp. v...   426   e-118
gb|CB875741.1|CB875741  HX09D14w HX Hordeum vulgare subsp. v...   426   e-118
gb|CK122902.1|CK122902  BES1824101c18 BES1824 Hordeum vulgar...   426   e-118
gb|CK124114.1|CK124114  BES1824107b22 BES1824 Hordeum vulgar...   426   e-118
gb|CK124897.1|CK124897  BES1824110p07 BES1824 Hordeum vulgar...   426   e-118
gb|CK124903.1|CK124903  BES1824110p13 BES1824 Hordeum vulgar...   426   e-118
gb|CK125127.1|CK125127  BES1824106m11 BES1824 Hordeum vulgar...   426   e-118
gb|AL507903.1|AL507903  AL507903 Hordeum vulgare Barke devel...   424   e-117
gb|AL508270.1|AL508270  AL508270 Hordeum vulgare Barke devel...   424   e-117
gb|AL511160.1|AL511160  AL511160 Hordeum vulgare Barke devel...   424   e-117
gb|BG343651.2|BG343651  HVSMEg0006C04f Hordeum vulgare pre-a...   424   e-117
gb|BG414201.2|BG414201  HVSMEk0001C03f Hordeum vulgare testa...   424   e-117
gb|AV913864.1|AV913864  AV913864 K. Sato unpublished cDNA li...   424   e-117
gb|AV914483.1|AV914483  AV914483 K. Sato unpublished cDNA li...   424   e-117
gb|AV916683.1|AV916683  AV916683 K. Sato unpublished cDNA li...   424   e-117
gb|AV919541.1|AV919541  AV919541 K. Sato unpublished cDNA li...   424   e-117
gb|AV921478.1|AV921478  AV921478 K. Sato unpublished cDNA li...   424   e-117
gb|AV921976.1|AV921976  AV921976 K. Sato unpublished cDNA li...   424   e-117
gb|BJ467216.1|BJ467216  BJ467216 K. Sato unpublished cDNA li...   424   e-117
gb|BQ458432.1|BQ458432  HA05D21r HA Hordeum vulgare subsp. v...   424   e-117
gb|BQ459568.1|BQ459568  HA08L24r HA Hordeum vulgare subsp. v...   424   e-117
gb|BQ463572.1|BQ463572  HI05L22r HI Hordeum vulgare subsp. v...   424   e-117
gb|BQ464515.1|BQ464515  HF02I01r HF Hordeum vulgare subsp. v...   424   e-117
gb|BQ470265.1|BQ470265  HX02F17r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ470361.1|BQ470361  HX02L10r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ470644.1|BQ470644  HX03J14r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ470663.1|BQ470663  HX03K10r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ470808.1|BQ470808  HX04B15r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ470872.1|BQ470872  HX04E19r HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ471610.1|BQ471610  HV02P02r HV Hordeum vulgare subsp. v...   424   e-117
gb|BQ665012.1|BQ665012  HX01M15w HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ665148.1|BQ665148  HX02F02u HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ665242.1|BQ665242  HX02L10u HX Hordeum vulgare subsp. v...   424   e-117
gb|BQ665546.1|BQ665546  HX04B15u HX Hordeum vulgare subsp. v...   424   e-117
gb|BM377844.2|BM377844  EBem04_SQ004_F15_R embryo, 12 DPA, n...   424   e-117
gb|BM377940.2|BM377940  EBem04_SQ004_K13_R embryo, 12 DPA, n...   424   e-117
gb|BM375238.2|BM375238  EBem06_SQ002_M05_R embryo, 21 DPA, n...   424   e-117
gb|BM374238.2|BM374238  EBpi03_SQ003_A24_R pistil, 4 DPA, no...   424   e-117
gb|BI778651.2|BI778651  EBro07_SQ003_O17_R root, 3 week, red...   424   e-117
gb|BU976260.1|BU976260  HA03G17r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU976261.1|BU976261  HA03G17u HA Hordeum vulgare subsp. v...   424   e-117
gb|BU976476.1|BU976476  HA03M08r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977085.1|BU977085  HA10N05r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977429.1|BU977429  HA11G15r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977515.1|BU977515  HA11I22r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977576.1|BU977576  HA11K15r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977623.1|BU977623  HA11M03r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU977762.1|BU977762  HA11P19r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU978339.1|BU978339  HA12P10r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU978648.1|BU978648  HA13N17r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU979364.1|BU979364  HA15O21r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU979873.1|BU979873  HA17K11r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU982152.1|BU982152  HA25K18r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU982782.1|BU982782  HA27J14r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU984074.1|BU984074  HA31O16r HA Hordeum vulgare subsp. v...   424   e-117
gb|BU988077.1|BU988077  HF16J14r HF Hordeum vulgare subsp. v...   424   e-117
gb|BU989705.1|BU989705  HF22H13r HF Hordeum vulgare subsp. v...   424   e-117
gb|BU998245.1|BU998245  HI10H05r HI Hordeum vulgare subsp. v...   424   e-117
gb|BU998983.1|BU998983  HI12N01r HI Hordeum vulgare subsp. v...   424   e-117
gb|BU999112.1|BU999112  HI13E20r HI Hordeum vulgare subsp. v...   424   e-117
gb|CA020770.1|CA020770  HZ37K14r HZ Hordeum vulgare subsp. v...   424   e-117
gb|CA022781.1|CA022781  HZ44F11r HZ Hordeum vulgare subsp. v...   424   e-117
gb|CA025788.1|CA025788  HZ53C09r HZ Hordeum vulgare subsp. v...   424   e-117
gb|CA026432.1|CA026432  HZ55O12r HZ Hordeum vulgare subsp. v...   424   e-117
gb|CA027454.1|CA027454  HZ58P15r HZ Hordeum vulgare subsp. v...   424   e-117
gb|CA029909.1|CA029909  HX05I20r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA030274.1|CA030274  HX06J09r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA030985.1|CA030985  HX08L03r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA030988.1|CA030988  HX08L06r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA031231.1|CA031231  HX09F24r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA031236.1|CA031236  HX09G05r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA031627.1|CA031627  HX10K04r HX Hordeum vulgare subsp. v...   424   e-117
gb|CA032945.1|CA032945  HX14K17r HX Hordeum vulgare subsp. v...   424   e-117
gb|CB859437.1|CB859437  HI10H05w HI Hordeum vulgare subsp. v...   424   e-117
gb|CB860148.1|CB860148  HI12N01w HI Hordeum vulgare subsp. v...   424   e-117
gb|CB874875.1|CB874875  HX06J09w HX Hordeum vulgare subsp. v...   424   e-117
gb|CB875567.1|CB875567  HX08L03w HX Hordeum vulgare subsp. v...   424   e-117
gb|CB875569.1|CB875569  HX08L06w HX Hordeum vulgare subsp. v...   424   e-117
gb|CB875796.1|CB875796  HX09F24w HX Hordeum vulgare subsp. v...   424   e-117
gb|CB875800.1|CB875800  HX09G05w HX Hordeum vulgare subsp. v...   424   e-117
gb|CV061223.1|CV061223  BNEL66c9 Barley EST endosperm librar...   424   e-117
gb|CV063882.1|CV063882  BNEL94c10 Barley EST endosperm libra...   424   e-117
gb|CK122795.1|CK122795  BES1824105p22 BES1824 Hordeum vulgar...   424   e-117
gb|CK123458.1|CK123458  BES1824104b19 BES1824 Hordeum vulgar...   424   e-117
gb|CK123930.1|CK123930  BES1824106d14 BES1824 Hordeum vulgar...   424   e-117
gb|CK124761.1|CK124761  BES1824110f02 BES1824 Hordeum vulgar...   424   e-117
gb|CK125093.1|CK125093  BES1824106l01 BES1824 Hordeum vulgar...   424   e-117
gb|AL503088.1|AL503088  AL503088 Hordeum vulgare Barke roots...   422   e-117
gb|AL509974.1|AL509974  AL509974 Hordeum vulgare Barke devel...   422   e-117
gb|AV914069.1|AV914069  AV914069 K. Sato unpublished cDNA li...   422   e-117
gb|AV918699.1|AV918699  AV918699 K. Sato unpublished cDNA li...   422   e-117
gb|AV919107.1|AV919107  AV919107 K. Sato unpublished cDNA li...   422   e-117
gb|AJ434597.1|AJ434597  AJ434597 S00002 Hordeum vulgare subs...   422   e-117
gb|BJ463181.1|BJ463181  BJ463181 K. Sato unpublished cDNA li...   422   e-117
gb|BQ470104.1|BQ470104  HX01M15T HX Hordeum vulgare subsp. v...   422   e-117
gb|BU977605.1|BU977605  HA11L14u HA Hordeum vulgare subsp. v...   422   e-117
gb|BU980154.1|BU980154  HA18N05r HA Hordeum vulgare subsp. v...   422   e-117
gb|BU983201.1|BU983201  HA28O02r HA Hordeum vulgare subsp. v...   422   e-117
gb|BU988718.1|BU988718  HF18H20r HF Hordeum vulgare subsp. v...   422   e-117
gb|CV054620.1|CV054620  BNEL111e11 Barley EST endosperm libr...   422   e-117
gb|AW982513.3|AW982513  HVSMEg0003H13f Hordeum vulgare pre-a...   420   e-116
gb|BG344489.2|BG344489  HVSMEg0009G18f Hordeum vulgare pre-a...   420   e-116
gb|AV924489.1|AV924489  AV924489 K. Sato unpublished cDNA li...   420   e-116
gb|AJ432104.1|AJ432104  AJ432104 S00002 Hordeum vulgare subs...   420   e-116
gb|BQ458704.1|BQ458704  HA04H06r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ458957.1|BQ458957  HA02L22r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ459072.1|BQ459072  HA02G16r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ459318.1|BQ459318  HA01I05r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ460371.1|BQ460371  HA09O09r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ460409.1|BQ460409  HA09L12r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ460612.1|BQ460612  HA06H11r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ460708.1|BQ460708  HA06C20r HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ463025.1|BQ463025  HI02M18r HI Hordeum vulgare subsp. v...   420   e-116
gb|BQ464453.1|BQ464453  HF02F07r HF Hordeum vulgare subsp. v...   420   e-116
gb|BQ469682.1|BQ469682  HZ01I20r HZ Hordeum vulgare subsp. v...   420   e-116
gb|BQ470423.1|BQ470423  HX02P01r HX Hordeum vulgare subsp. v...   420   e-116
gb|BQ470653.1|BQ470653  HX03J23r HX Hordeum vulgare subsp. v...   420   e-116
gb|BQ470680.1|BQ470680  HX03L04r HX Hordeum vulgare subsp. v...   420   e-116
gb|BQ471010.1|BQ471010  HX04L06r HX Hordeum vulgare subsp. v...   420   e-116
gb|BQ656308.1|BQ656308  HA04P18u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ656641.1|BQ656641  HA02L22u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ656653.1|BQ656653  HA02L01u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ656926.1|BQ656926  HA01H13u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ656931.1|BQ656931  HA01G20u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ657914.1|BQ657914  HA06H11u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ657984.1|BQ657984  HA06C20u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ658125.1|BQ658125  HA05J24u HA Hordeum vulgare subsp. v...   420   e-116
gb|BQ665300.1|BQ665300  HX02P01u HX Hordeum vulgare subsp. v...   420   e-116
gb|BQ665440.1|BQ665440  HX03J23u HX Hordeum vulgare subsp. v...   420   e-116
gb|BM097546.2|BM097546  EBem04_SQ001_P09_R embryo, 12 DPA, n...   420   e-116
gb|BM097600.2|BM097600  EBem04_SQ002_C18_R embryo, 12 DPA, n...   420   e-116
gb|BM377400.2|BM377400  EBem04_SQ003_A09_R embryo, 12 DPA, n...   420   e-116
gb|BM377104.2|BM377104  EBem05_SQ004_C07_R embryo, 14 DPA, n...   420   e-116
gb|BM369409.2|BM369409  EBem07_SQ003_I01_R embryo, 28 DPA, n...   420   e-116
gb|BM369552.2|BM369552  EBem07_SQ003_O23_R embryo, 28 DPA, n...   420   e-116
gb|BM368469.2|BM368469  EBem08_SQ002_G09_R embryo, 40 DPA, n...   420   e-116
gb|BM376204.2|BM376204  EBma01_SQ002_K14_R maternal, 4 DPA, ...   420   e-116
gb|BM372981.2|BM372981  EBma04_SQ002_K04_R maternal, 10 DPA,...   420   e-116
gb|BQ762302.1|BQ762302  EBro01_SQ005_M07 _R root, 3 week, hy...   420   e-116
gb|BQ764045.1|BQ764045  EBro03_SQ006_J03_R root, 3 week, wat...   420   e-116
gb|BU968833.1|BU968833  HB08L16r BC Hordeum vulgare subsp. v...   420   e-116
gb|BU976059.1|BU976059  HA03B03r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU976782.1|BU976782  HA10E21r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU977488.1|BU977488  HA11I06r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU977489.1|BU977489  HA11I06u HA Hordeum vulgare subsp. v...   420   e-116
gb|BU978961.1|BU978961  HA14M07r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU979689.1|BU979689  HA16P04r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU980385.1|BU980385  HA20I06r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU983289.1|BU983289  HA29D05r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU983430.1|BU983430  HA29L09r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU983508.1|BU983508  HA29P11r HA Hordeum vulgare subsp. v...   420   e-116
gb|BU987448.1|BU987448  HF14M14r HF Hordeum vulgare subsp. v...   420   e-116
gb|BU989076.1|BU989076  HF19L03r HF Hordeum vulgare subsp. v...   420   e-116
gb|BU997451.1|BU997451  HI08A13r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU997943.1|BU997943  HI09H22r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU997963.1|BU997963  HI09I21r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU998730.1|BU998730  HI11P23r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU998753.1|BU998753  HI12B02r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU998979.1|BU998979  HI12M21r HI Hordeum vulgare subsp. v...   420   e-116
gb|BU999505.1|BU999505  HI14L12r HI Hordeum vulgare subsp. v...   420   e-116
gb|CA009686.1|CA009686  HU14N07r HU Hordeum vulgare subsp. v...   420   e-116
gb|CA016942.1|CA016942  HV05L04u HV Hordeum vulgare subsp. v...   420   e-116
gb|CA017608.1|CA017608  HV05L04r HV Hordeum vulgare subsp. v...   420   e-116
gb|CA024571.1|CA024571  HZ49K24r HZ Hordeum vulgare subsp. v...   420   e-116
gb|CA026603.1|CA026603  HZ56G05r HZ Hordeum vulgare subsp. v...   420   e-116
gb|CA028384.1|CA028384  HZ61N03r HZ Hordeum vulgare subsp. v...   420   e-116
gb|CA028683.1|CA028683  HZ62O15r HZ Hordeum vulgare subsp. v...   420   e-116
gb|CA030969.1|CA030969  HX08K11r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA031459.1|CA031459  HX10A11r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA031585.1|CA031585  HX10G22r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA031751.1|CA031751  HX11A11r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA032080.1|CA032080  HX11P06r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA032478.1|CA032478  HX13C20r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA032666.1|CA032666  HX13N08r HX Hordeum vulgare subsp. v...   420   e-116
gb|CA032869.1|CA032869  HX14G23r HX Hordeum vulgare subsp. v...   420   e-116
gb|BJ549089.1|BJ549089  BJ549089 K. Sato unpublished cDNA li...   420   e-116
gb|BJ549692.1|BJ549692  BJ549692 K. Sato unpublished cDNA li...   420   e-116
gb|CB858696.1|CB858696  HI08A13w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB859143.1|CB859143  HI09H22w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB859163.1|CB859163  HI09I21w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB859915.1|CB859915  HI11P23w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB859938.1|CB859938  HI12B02w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB860144.1|CB860144  HI12M21w HI Hordeum vulgare subsp. v...   420   e-116
gb|CB875552.1|CB875552  HX08K11w HX Hordeum vulgare subsp. v...   420   e-116
gb|CB876195.1|CB876195  HX10J03w HX Hordeum vulgare subsp. v...   420   e-116
gb|CB876333.1|CB876333  HX10P14w HX Hordeum vulgare subsp. v...   420   e-116
gb|CB876354.1|CB876354  HX11A11w HX Hordeum vulgare subsp. v...   420   e-116
gb|CB876656.1|CB876656  HX11P06w HX Hordeum vulgare subsp. v...   420   e-116
gb|CV054416.1|CV054416  BNEL10C5 Barley EST endosperm librar...   420   e-116
gb|CV056751.1|CV056751  BNEL20c1 Barley EST endosperm librar...   420   e-116
gb|CV057640.1|CV057640  BNEL2B12 Barley EST endosperm librar...   420   e-116
gb|CV058136.1|CV058136  BNEL34g11 Barley EST endosperm libra...   420   e-116
gb|CV059558.1|CV059558  BNEL49d8 Barley EST endosperm librar...   420   e-116
>gb|BM376670.2|BM376670 EBem05_SQ002_O03_R embryo, 14 DPA, no treatment, cv Optic, EBem05
           Hordeum vulgare subsp. vulgare cDNA clone
           EBem05_SQ002_O03 5', mRNA sequence
          Length = 580

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 514 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 455

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 454 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 395

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 394 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 335

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 275

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 274 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 215

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 214 ttgcccttcttctcgccgccgtccttgcc 186

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 110 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 58

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 131 ggccttctccgccgtcggctcctcctccgcgggcttcttc 92
>gb|BM375871.2|BM375871 EBem06_SQ004_K11_R embryo, 21 DPA, no treatment, cv Optic, EBem06
           Hordeum vulgare subsp. vulgare cDNA clone
           EBem06_SQ004_K11 5', mRNA sequence
          Length = 534

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 522 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 463

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 462 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 403

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 402 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 343

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 342 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 283

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 282 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 223

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 222 ttgcccttcttctcgccgccgtccttgcc 194

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 118 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 66

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 139 ggccttctccgccgtcggctcctcctccgcgggcttcttc 100
>gb|BM374033.2|BM374033 EBma03_SQ003_H07_R maternal, 8 DPA, no treatment, cv Optic, EBma03
           Hordeum vulgare subsp. vulgare cDNA clone
           EBma03_SQ003_H07 5', mRNA sequence
          Length = 588

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 522 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 463

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 462 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 403

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 402 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 343

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 342 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 283

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 282 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 223

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 222 ttgcccttcttctcgccgccgtccttgcc 194

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 118 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 66

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 139 ggccttctccgccgtcggctcctcctccgcgggcttcttc 100
>gb|BU978977.1|BU978977 HA14M24r HA Hordeum vulgare subsp. vulgare cDNA clone HA14M24
           5-PRIME, mRNA sequence
          Length = 643

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 536 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 477

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 476 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 417

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 416 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 357

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 356 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 297

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 296 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 237

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 236 ttgcccttcttctcgccgccgtccttgcc 208

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 132 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 80

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 153 ggccttctccgccgtcggctcctcctccgcgggcttcttc 114
>gb|BU982853.1|BU982853 HA27M23r HA Hordeum vulgare subsp. vulgare cDNA clone HA27M23
           5-PRIME, mRNA sequence
          Length = 556

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 534 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 475

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 474 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 415

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 414 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 355

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 354 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 295

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 294 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 235

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 234 ttgcccttcttctcgccgccgtccttgcc 206

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 130 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 78

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 151 ggccttctccgccgtcggctcctcctccgcgggcttcttc 112
>gb|CA031769.1|CA031769 HX11B09r HX Hordeum vulgare subsp. vulgare cDNA clone HX11B09
           5-PRIME, mRNA sequence
          Length = 561

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 357 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 298

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 297 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 238

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 237 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 178

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 177 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 118

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 117 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 58

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 57  ttgcccttcttctcgccgccgtccttgcc 29
>gb|CK123061.1|CK123061 BES1824101p23 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
           MPMGp2010P231 5-PRIME, mRNA sequence
          Length = 739

 Score =  486 bits (245), Expect = e-136
 Identities = 308/329 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 514 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 455

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 454 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 395

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 394 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 335

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 275

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 274 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 215

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 214 ttgcccttcttctcgccgccgtccttgcc 186

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 110 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 58

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 131 ggccttctccgccgtcggctcctcctccgcgggcttcttc 92
>gb|AL507937.1|AL507937 AL507937 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
           Hordeum vulgare subsp. vulgare cDNA clone HY07E20V 5',
           mRNA sequence
          Length = 562

 Score =  480 bits (242), Expect = e-134
 Identities = 307/329 (93%)
 Strand = Plus / Plus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 102 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 161

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 162 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 221

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||| ||||||
Sbjct: 222 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaanatgtcg 281

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 282 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 341

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 342 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 401

                                        
Query: 612 ttccccttcttctcgccgccctccttgcc 640
           || ||||||||||||||||| ||||||||
Sbjct: 402 ttgcccttcttctcgccgccgtccttgcc 430

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 506 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 558

 Score = 56.0 bits (28), Expect = 2e-006
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           |||||||||| ||||||||| || ||||||||||||||||
Sbjct: 485 ggccttctccgccgtcggctcctcctccgcgggcttcttc 524
>gb|BQ459604.1|BQ459604 HA08K08r HA Hordeum vulgare subsp. vulgare cDNA clone HA08K08
           5-PRIME, mRNA sequence
          Length = 547

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 488 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 429

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 428 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 369

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 368 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 309

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 308 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 249

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 248 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 189

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 188 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 129

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 128 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 76
>gb|BU976197.1|BU976197 HA03F02r HA Hordeum vulgare subsp. vulgare cDNA clone HA03F02
           5-PRIME, mRNA sequence
          Length = 529

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 483 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 424

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 423 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 364

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 363 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 304

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 303 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 244

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 243 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 184

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 183 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 124

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 123 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 71
>gb|BU978624.1|BU978624 HA13M12r HA Hordeum vulgare subsp. vulgare cDNA clone HA13M12
           5-PRIME, mRNA sequence
          Length = 607

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 486 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 427

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 426 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 367

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 366 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 307

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 306 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 247

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 246 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 187

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 186 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 127

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 126 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 74
>gb|BU983681.1|BU983681 HA30K05r HA Hordeum vulgare subsp. vulgare cDNA clone HA30K05
           5-PRIME, mRNA sequence
          Length = 538

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 488 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 429

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 428 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 369

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 368 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 309

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 308 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 249

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 248 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 189

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 188 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 129

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 128 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 76
>gb|CA024661.1|CA024661 HZ49P02r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ49P02
           5-PRIME, mRNA sequence
          Length = 595

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 474 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 415

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 414 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 355

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 354 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 295

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 294 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 235

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 234 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 175

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 174 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 115

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 114 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 62
>gb|CA028149.1|CA028149 HZ61C08r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ61C08
           5-PRIME, mRNA sequence
          Length = 593

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 476 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 417

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 416 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 357

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 356 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 297

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 296 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 237

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 236 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 177

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 176 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 117

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 116 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 64
>gb|CB883569.1|CB883569 HQ02K12w HQ Hordeum vulgare subsp. vulgare cDNA clone HQ02K12
           3-PRIME, mRNA sequence
          Length = 631

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 490 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 431

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 430 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 371

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 370 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 311

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 310 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 251

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 250 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 191

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 190 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 131

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 130 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 78
>gb|CV053818.1|CV053818 BNEL103e4 Barley EST endosperm library Hordeum vulgare subsp.
           vulgare cDNA clone BNEL103e4 5' similar to histone H2B-6
           - wheat, mRNA sequence
          Length = 643

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 481 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 422

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 421 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 362

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 361 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 302

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 301 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 242

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 241 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 182

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 181 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 122

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 121 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 69
>gb|CV056345.1|CV056345 BNEL16F6 Barley EST endosperm library Hordeum vulgare subsp.
           vulgare cDNA clone BNEL16F6 5' similar to histone H2B-6
           - wheat, mRNA sequence
          Length = 592

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 479 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 420

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 419 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 360

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 359 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 300

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 299 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 240

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 239 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 180

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 179 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 120

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 119 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 67
>gb|CV061361.1|CV061361 BNEL67h8 Barley EST endosperm library Hordeum vulgare subsp.
           vulgare cDNA clone BNEL67h8 5' similar to histone H2B-6
           - wheat, mRNA sequence
          Length = 586

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 479 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 420

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 419 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 360

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 359 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 300

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 299 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 240

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 239 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 180

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 179 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 120

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 119 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 67
>gb|CV063444.1|CV063444 BNEL8D2 Barley EST endosperm library Hordeum vulgare subsp. vulgare
           cDNA clone BNEL8D2 5' similar to histone H2B-6 - wheat,
           mRNA sequence
          Length = 547

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 409

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|CK122911.1|CK122911 BES1824101d03 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
           MPMGp2010D031 5-PRIME, mRNA sequence
          Length = 613

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 471 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 412

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 411 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 352

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 351 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 292

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 291 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 232

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 231 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 172

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 171 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 112

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 111 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 59
>gb|CK124134.1|CK124134 BES1824107c19 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
           MPMGp2010C197 5-PRIME, mRNA sequence
          Length = 638

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 480 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 421

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 420 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 361

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 360 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 301

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 300 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 241

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 240 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 181

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 180 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 121

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 120 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 68
>gb|CK124193.1|CK124193 BES1824107f18 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
           MPMGp2010F187 5-PRIME, mRNA sequence
          Length = 651

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 483 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 424

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 423 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 364

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 363 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 304

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 303 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 244

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 243 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 184

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 183 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 124

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 123 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 71
>gb|CK124884.1|CK124884 BES1824110o17 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
           MPMGp2010O1710 5-PRIME, mRNA sequence
          Length = 619

 Score =  480 bits (242), Expect = e-134
 Identities = 373/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 425

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BJ464995.1|BJ464995 BJ464995 K. Sato unpublished cDNA library, cv. Haruna Nijo
           germination shoots Hordeum vulgare subsp. vulgare cDNA
           clone bags36o05 5', mRNA sequence
          Length = 581

 Score =  476 bits (240), Expect = e-133
 Identities = 300/320 (93%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 364 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 305

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 304 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 245

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 244 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 185

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 184 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 125

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 124 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 65

                               
Query: 612 ttccccttcttctcgccgcc 631
           || |||||||||||||||||
Sbjct: 64  ttgcccttcttctcgccgcc 45
>gb|CB876373.1|CB876373 HX11B09w HX Hordeum vulgare subsp. vulgare cDNA clone HX11B09
           3-PRIME, mRNA sequence
          Length = 525

 Score =  476 bits (240), Expect = e-133
 Identities = 300/320 (93%)
 Strand = Plus / Plus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 205 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 264

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           ||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 265 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 324

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           |||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||
Sbjct: 325 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 384

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 385 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 444

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 445 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 504

                               
Query: 612 ttccccttcttctcgccgcc 631
           || |||||||||||||||||
Sbjct: 505 ttgcccttcttctcgccgcc 524
>gb|CA014353.1|CA014353 HT11B21r HT Hordeum vulgare subsp. vulgare cDNA clone HT11B21
           5-PRIME, mRNA sequence
          Length = 588

 Score =  474 bits (239), Expect = e-132
 Identities = 370/413 (89%), Gaps = 3/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 318 taagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagc 377
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 461 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 402

                                                                       
Query: 378 tcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttc 437
           ||||| || ||||||||||| || |  |||||||||||||||||||| ||||||||||||
Sbjct: 401 tcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttc 342

                                                                       
Query: 438 ttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatg 497
           ||||||||||| ||||||||||| | |||| | || ||||||||||||||||||||||||
Sbjct: 341 ttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatg 282

                                                                       
Query: 498 aaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgcttg 557
           ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||||||||
Sbjct: 281 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttg 222

                                                                       
Query: 558 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttcccc 617
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |
Sbjct: 221 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttcttc 162

                                                                       
Query: 618 ttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcggcc 677
           || |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| || 
Sbjct: 161 ttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc- 103

                                                                
Query: 678 ttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 102 --ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 52
>gb|BF254096.3|BF254096 HVSMEf0003A06f Hordeum vulgare seedling root EST library HVcDNA0007
           (Etiolated and unstressed) Hordeum vulgare subsp.
           vulgare cDNA clone HVSMEf0003A06f, mRNA sequence
          Length = 824

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 409

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|BM097641.2|BM097641 EBem04_SQ002_E17_R embryo, 12 DPA, no treatment, cv Optic, EBem04
           Hordeum vulgare subsp. vulgare cDNA clone
           EBem04_SQ002_E17 5', mRNA sequence
          Length = 505

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 425

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BM100628.2|BM100628 EBma01_SQ005_M10_R maternal, 4 DPA, no treatment, cv Optic, EBma01
           Hordeum vulgare subsp. vulgare cDNA clone
           EBma01_SQ005_M10 5', mRNA sequence
          Length = 606

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 409

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|BI778732.2|BI778732 EBro01_SQ001_E06_R root, 3 week, hydroponic grown, no treatment, cv
           Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
           EBro01_SQ001_E06 5', mRNA sequence
          Length = 609

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 425

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BQ759749.1|BQ759749 EBpi05_SQ004_D11_R pistil, 8 DPA, no treatment, cv Optic, EBpi05
           Hordeum vulgare subsp. vulgare cDNA clone
           EBpi05_SQ004_D11 5', mRNA sequence
          Length = 612

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 470 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 411

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 410 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 351

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 350 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 291

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 290 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 231

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 230 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 171

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 170 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 111

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 110 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 58
>gb|BQ767014.1|BQ767014 EBro08_SQ007_B19_R root, 3 week, drought-stressed, cv Optic, EBro08
           Hordeum vulgare subsp. vulgare cDNA clone
           EBro08_SQ007_B19 5', mRNA sequence
          Length = 627

 Score =  472 bits (238), Expect = e-132
 Identities = 372/416 (89%), Gaps = 3/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
           ||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 473 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 414

                                                                       
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
           |||||||| || ||||||||||| || |  |||||||||||||||||||| |||||||||
Sbjct: 413 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 354

                                                                       
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
           |||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 353 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 294

                                                                       
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
           |||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 293 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 234

                                                                       
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 233 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 174

                                                                       
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
             ||| |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| 
Sbjct: 173 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 114

                                                                   
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
           ||   |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 113 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|BQ458920.1|BQ458920 HA02N15r HA Hordeum vulgare subsp. vulgare cDNA clone HA02N15
           5-PRIME, mRNA sequence
          Length = 538

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|BQ657190.1|BQ657190 HA09E24u HA Hordeum vulgare subsp. vulgare cDNA clone HA09E24
           3-PRIME, mRNA sequence
          Length = 522

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Plus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 148 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 207

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 208 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 267

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 268 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 327

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 328 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 387

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 388 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 447

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 448 ctgcccttcttctcgccgccctccttg 474
>gb|BM097856.2|BM097856 EBem04_SQ002_O11_R embryo, 12 DPA, no treatment, cv Optic, EBem04
           Hordeum vulgare subsp. vulgare cDNA clone
           EBem04_SQ002_O11 5', mRNA sequence
          Length = 521

 Score =  466 bits (235), Expect = e-130
 Identities = 369/413 (89%), Gaps = 3/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 318 taagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagc 377
           |||||||| || |||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 466 taagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcgagc 407

                                                                       
Query: 378 tcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttc 437
           ||||| || ||||||||||| || |  |||||||||||||||||||| ||||||||||||
Sbjct: 406 tcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttc 347

                                                                       
Query: 438 ttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatg 497
           ||||||||||| ||||||||||| | |||| | || ||||||||||||||||||||||||
Sbjct: 346 ttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatg 287

                                                                       
Query: 498 aaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgcttg 557
           ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||||||||
Sbjct: 286 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttg 227

                                                                       
Query: 558 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttcccc 617
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |
Sbjct: 226 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttcttc 167

                                                                       
Query: 618 ttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcggcc 677
           || |   ||||||| |||||||| |||||||||||||| ||| ||||||||||||| || 
Sbjct: 166 ttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc- 108

                                                                
Query: 678 ttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             |||| | | |  ||||| | |||||||||||||||||||||||||||||||
Sbjct: 107 --ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 57
>gb|BM377645.2|BM377645 EBem04_SQ003_M03_R embryo, 12 DPA, no treatment, cv Optic, EBem04
           Hordeum vulgare subsp. vulgare cDNA clone
           EBem04_SQ003_M03 5', mRNA sequence
          Length = 568

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 518 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 459

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 458 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 399

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 398 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 339

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 338 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 279

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 278 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 219

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 218 ctgcccttcttctcgccgccctccttg 192

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 132 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 87

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 105 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 53
>gb|BQ768768.1|BQ768768 EBro08_SQ012_M13_R root, 3 week, drought-stressed, cv Optic, EBro08
           Hordeum vulgare subsp. vulgare cDNA clone
           EBro08_SQ012_M13 5', mRNA sequence
          Length = 521

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 517 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 458

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 457 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 398

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 397 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 338

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 337 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 278

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 277 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 218

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 217 ctgcccttcttctcgccgccctccttg 191

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 131 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 86

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 104 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 52
>gb|BU977854.1|BU977854 HA12C14r HA Hordeum vulgare subsp. vulgare cDNA clone HA12C14
           5-PRIME, mRNA sequence
          Length = 462

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 458 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 399

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 398 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 339

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 338 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 279

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 278 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 219

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 218 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 159

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 158 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 102

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 101 ttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|BU978804.1|BU978804 HA14F04r HA Hordeum vulgare subsp. vulgare cDNA clone HA14F04
           5-PRIME, mRNA sequence
          Length = 592

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 537 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 478

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 477 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 418

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 417 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 358

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 357 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 298

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 297 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 238

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 237 ctgcccttcttctcgccgccctccttg 211

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 151 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 106

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 124 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 72
>gb|BU979516.1|BU979516 HA16G16r HA Hordeum vulgare subsp. vulgare cDNA clone HA16G16
           5-PRIME, mRNA sequence
          Length = 475

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 471 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 412

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 411 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 352

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 351 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 292

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 291 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 232

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 231 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 172

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 171 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 115

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 114 ttcttctccgccgcgggcttcttctcggccttgggcgccat 74
>gb|BU979612.1|BU979612 HA16L11r HA Hordeum vulgare subsp. vulgare cDNA clone HA16L11
           5-PRIME, mRNA sequence
          Length = 542

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|BU979716.1|BU979716 HA17A16r HA Hordeum vulgare subsp. vulgare cDNA clone HA17A16
           5-PRIME, mRNA sequence
          Length = 434

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 429 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 370

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 369 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 310

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 309 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 250

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 249 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 190

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 189 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 130

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 129 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 73

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 72  ttcttctccgccgcgggcttcttctcggccttgggcgccat 32
>gb|BU980231.1|BU980231 HA20B03r HA Hordeum vulgare subsp. vulgare cDNA clone HA20B03
           5-PRIME, mRNA sequence
          Length = 547

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 532 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 473

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 472 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 413

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 412 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 353

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 352 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 293

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 292 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 233

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 232 ctgcccttcttctcgccgccctccttg 206

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 146 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 101

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 119 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 67
>gb|BU981929.1|BU981929 HA25A12r HA Hordeum vulgare subsp. vulgare cDNA clone HA25A12
           5-PRIME, mRNA sequence
          Length = 550

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 540 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 481

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 480 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 421

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 420 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 361

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 360 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 301

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 300 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 241

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 240 ctgcccttcttctcgccgccctccttg 214

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 154 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 109

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 127 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 75
>gb|BU983269.1|BU983269 HA29C08r HA Hordeum vulgare subsp. vulgare cDNA clone HA29C08
           5-PRIME, mRNA sequence
          Length = 462

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 458 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 399

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 398 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 339

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 338 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 279

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 278 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 219

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 218 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 159

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 158 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 102

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 101 ttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|CA012215.1|CA012215 HT04M17r HT Hordeum vulgare subsp. vulgare cDNA clone HT04M17
           5-PRIME, mRNA sequence
          Length = 468

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 462 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 403

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 402 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 343

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 342 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 283

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 282 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 223

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 222 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 163

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 162 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 106

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 105 ttcttctccgccgcgggcttcttctcggccttgggcgccat 65
>gb|CA018589.1|CA018589 HV09B05r HV Hordeum vulgare subsp. vulgare cDNA clone HV09B05
           5-PRIME, mRNA sequence
          Length = 602

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|CA028621.1|CA028621 HZ62K14r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ62K14
           5-PRIME, mRNA sequence
          Length = 468

 Score =  466 bits (235), Expect = e-130
 Identities = 360/401 (89%), Gaps = 3/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 460 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 401

                                                                       
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
           |||||||| || |  |||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 400 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 341

                                                                       
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
           ||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 340 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 281

                                                                       
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
           ||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 280 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 221

                                                                       
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
           |||||||||||||||||||| ||||||||||||||||||||||||  ||| |   |||||
Sbjct: 220 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 161

                                                                       
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
           || |||||||| |||||||||||||| ||| ||||||||||||| ||   |||| | | |
Sbjct: 160 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 104

                                                    
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
             ||||| | |||||||||||||||||||||||||||||||
Sbjct: 103 ttcttctccgccgcgggcttcttctcggccttgggcgccat 63
>gb|CA031561.1|CA031561 HX10G09r HX Hordeum vulgare subsp. vulgare cDNA clone HX10G09
           5-PRIME, mRNA sequence
          Length = 516

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 497 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 438

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 437 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 378

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 377 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 318

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 317 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 258

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 257 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 198

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 197 ctgcccttcttctcgccgccctccttg 171

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 111 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 66

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 84  ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 32
>gb|CA032140.1|CA032140 HX12C05r HX Hordeum vulgare subsp. vulgare cDNA clone HX12C05
           5-PRIME, mRNA sequence
          Length = 630

 Score =  466 bits (235), Expect = e-130
 Identities = 304/327 (92%)
 Strand = Plus / Minus

                                                                       
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 506 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 447

                                                                       
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
           |||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 446 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 387

                                                                       
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
           ||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 386 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 327

                                                                       
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
           ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 326 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 267

                                                                       
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
           |||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 266 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 207

                                      
Query: 612 ttccccttcttctcgccgccctccttg 638
            | ||||||||||||||||||||||||
Sbjct: 206 ctgcccttcttctcgccgccctccttg 180

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
           ||||||||||||||||  |||||||| || ||||||||||||||||
Sbjct: 120 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 75

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
           ||||||||  ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 93  ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 41
  Database: Hordeum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:16 PM
  Number of letters in database: 175,134,539
  Number of sequences in database:  312,970
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 143,074
Number of Sequences: 312970
Number of extensions: 143074
Number of successful extensions: 50766
Number of sequences better than  0.5: 1539
Number of HSP's better than  0.5 without gapping: 1539
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41919
Number of HSP's gapped (non-prelim): 8272
length of query: 842
length of database: 175,134,539
effective HSP length: 19
effective length of query: 823
effective length of database: 169,188,109
effective search space: 139241813707
effective search space used: 139241813707
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)