BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.355
(842 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BM376670.2|BM376670 EBem05_SQ002_O03_R embryo, 14 DPA, n... 486 e-136
gb|BM375871.2|BM375871 EBem06_SQ004_K11_R embryo, 21 DPA, n... 486 e-136
gb|BM374033.2|BM374033 EBma03_SQ003_H07_R maternal, 8 DPA, ... 486 e-136
gb|BU978977.1|BU978977 HA14M24r HA Hordeum vulgare subsp. v... 486 e-136
gb|BU982853.1|BU982853 HA27M23r HA Hordeum vulgare subsp. v... 486 e-136
gb|CA031769.1|CA031769 HX11B09r HX Hordeum vulgare subsp. v... 486 e-136
gb|CK123061.1|CK123061 BES1824101p23 BES1824 Hordeum vulgar... 486 e-136
gb|AL507937.1|AL507937 AL507937 Hordeum vulgare Barke devel... 480 e-134
gb|BQ459604.1|BQ459604 HA08K08r HA Hordeum vulgare subsp. v... 480 e-134
gb|BU976197.1|BU976197 HA03F02r HA Hordeum vulgare subsp. v... 480 e-134
gb|BU978624.1|BU978624 HA13M12r HA Hordeum vulgare subsp. v... 480 e-134
gb|BU983681.1|BU983681 HA30K05r HA Hordeum vulgare subsp. v... 480 e-134
gb|CA024661.1|CA024661 HZ49P02r HZ Hordeum vulgare subsp. v... 480 e-134
gb|CA028149.1|CA028149 HZ61C08r HZ Hordeum vulgare subsp. v... 480 e-134
gb|CB883569.1|CB883569 HQ02K12w HQ Hordeum vulgare subsp. v... 480 e-134
gb|CV053818.1|CV053818 BNEL103e4 Barley EST endosperm libra... 480 e-134
gb|CV056345.1|CV056345 BNEL16F6 Barley EST endosperm librar... 480 e-134
gb|CV061361.1|CV061361 BNEL67h8 Barley EST endosperm librar... 480 e-134
gb|CV063444.1|CV063444 BNEL8D2 Barley EST endosperm library... 480 e-134
gb|CK122911.1|CK122911 BES1824101d03 BES1824 Hordeum vulgar... 480 e-134
gb|CK124134.1|CK124134 BES1824107c19 BES1824 Hordeum vulgar... 480 e-134
gb|CK124193.1|CK124193 BES1824107f18 BES1824 Hordeum vulgar... 480 e-134
gb|CK124884.1|CK124884 BES1824110o17 BES1824 Hordeum vulgar... 480 e-134
gb|BJ464995.1|BJ464995 BJ464995 K. Sato unpublished cDNA li... 476 e-133
gb|CB876373.1|CB876373 HX11B09w HX Hordeum vulgare subsp. v... 476 e-133
gb|CA014353.1|CA014353 HT11B21r HT Hordeum vulgare subsp. v... 474 e-132
gb|BF254096.3|BF254096 HVSMEf0003A06f Hordeum vulgare seedl... 472 e-132
gb|BM097641.2|BM097641 EBem04_SQ002_E17_R embryo, 12 DPA, n... 472 e-132
gb|BM100628.2|BM100628 EBma01_SQ005_M10_R maternal, 4 DPA, ... 472 e-132
gb|BI778732.2|BI778732 EBro01_SQ001_E06_R root, 3 week, hyd... 472 e-132
gb|BQ759749.1|BQ759749 EBpi05_SQ004_D11_R pistil, 8 DPA, no... 472 e-132
gb|BQ767014.1|BQ767014 EBro08_SQ007_B19_R root, 3 week, dro... 472 e-132
gb|BQ458920.1|BQ458920 HA02N15r HA Hordeum vulgare subsp. v... 466 e-130
gb|BQ657190.1|BQ657190 HA09E24u HA Hordeum vulgare subsp. v... 466 e-130
gb|BM097856.2|BM097856 EBem04_SQ002_O11_R embryo, 12 DPA, n... 466 e-130
gb|BM377645.2|BM377645 EBem04_SQ003_M03_R embryo, 12 DPA, n... 466 e-130
gb|BQ768768.1|BQ768768 EBro08_SQ012_M13_R root, 3 week, dro... 466 e-130
gb|BU977854.1|BU977854 HA12C14r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU978804.1|BU978804 HA14F04r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU979516.1|BU979516 HA16G16r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU979612.1|BU979612 HA16L11r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU979716.1|BU979716 HA17A16r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU980231.1|BU980231 HA20B03r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU981929.1|BU981929 HA25A12r HA Hordeum vulgare subsp. v... 466 e-130
gb|BU983269.1|BU983269 HA29C08r HA Hordeum vulgare subsp. v... 466 e-130
gb|CA012215.1|CA012215 HT04M17r HT Hordeum vulgare subsp. v... 466 e-130
gb|CA018589.1|CA018589 HV09B05r HV Hordeum vulgare subsp. v... 466 e-130
gb|CA028621.1|CA028621 HZ62K14r HZ Hordeum vulgare subsp. v... 466 e-130
gb|CA031561.1|CA031561 HX10G09r HX Hordeum vulgare subsp. v... 466 e-130
gb|CA032140.1|CA032140 HX12C05r HX Hordeum vulgare subsp. v... 466 e-130
gb|CA032241.1|CA032241 HX12H04r HX Hordeum vulgare subsp. v... 466 e-130
gb|CB876207.1|CB876207 HX10J16w HX Hordeum vulgare subsp. v... 466 e-130
gb|CK122016.1|CK122016 BES1824101a01 BES1824 Hordeum vulgar... 466 e-130
gb|CK124222.1|CK124222 BES1824108a13 BES1824 Hordeum vulgar... 466 e-130
gb|CK125189.1|CK125189 BES1824106p12 BES1824 Hordeum vulgar... 466 e-130
gb|BJ464563.1|BJ464563 BJ464563 K. Sato unpublished cDNA li... 464 e-129
gb|BJ464912.1|BJ464912 BJ464912 K. Sato unpublished cDNA li... 464 e-129
gb|BJ466914.1|BJ466914 BJ466914 K. Sato unpublished cDNA li... 464 e-129
gb|BI780644.2|BI780644 EBes01_SQ001_J19_R embryo sac, 4-6 D... 464 e-129
gb|CV056586.1|CV056586 BNEL19D6 Barley EST endosperm librar... 464 e-129
gb|BG418559.2|BG418559 HVSMEk0023C06f Hordeum vulgare testa... 462 e-129
gb|BM099812.2|BM099812 EBes01_SQ004_F15_R embryo sac, 4-6 D... 458 e-127
gb|BI777807.2|BI777807 EBro08_SQ002_C08_R root, 3 week, dro... 458 e-127
gb|CA018186.1|CA018186 HV07O01r HV Hordeum vulgare subsp. v... 458 e-127
gb|BF627236.3|BF627236 HVSMEb0004F01f Hordeum vulgare seedl... 456 e-127
gb|BG343707.2|BG343707 HVSMEg0006I11f Hordeum vulgare pre-a... 456 e-127
gb|BG344491.2|BG344491 HVSMEg0009G20f Hordeum vulgare pre-a... 456 e-127
gb|AV919881.1|AV919881 AV919881 K. Sato unpublished cDNA li... 456 e-127
gb|BQ470411.1|BQ470411 HX02O12r HX Hordeum vulgare subsp. v... 456 e-127
gb|BQ470518.1|BQ470518 HX03D15r HX Hordeum vulgare subsp. v... 456 e-127
gb|BM377599.2|BM377599 EBem04_SQ003_K01_R embryo, 12 DPA, n... 456 e-127
gb|BM375013.2|BM375013 EBem06_SQ002_B10_R embryo, 21 DPA, n... 456 e-127
gb|BM097367.2|BM097367 EBro01_SQ004_O21_R root, 3 week, hyd... 456 e-127
gb|BM370921.2|BM370921 EBro04_SQ002_N13_R root, 3 week, sal... 456 e-127
gb|BQ754233.1|BQ754233 EBca01_SQ003_E10_R carpel, pre-anthe... 456 e-127
gb|BU968806.1|BU968806 HB08K09r BC Hordeum vulgare subsp. v... 456 e-127
gb|BU979604.1|BU979604 HA16L03r HA Hordeum vulgare subsp. v... 456 e-127
gb|BU981167.1|BU981167 HA22N07r HA Hordeum vulgare subsp. v... 456 e-127
gb|BU981798.1|BU981798 HA24K18r HA Hordeum vulgare subsp. v... 456 e-127
gb|BU983259.1|BU983259 HA29B15r HA Hordeum vulgare subsp. v... 456 e-127
gb|BU984036.1|BU984036 HA31M20r HA Hordeum vulgare subsp. v... 456 e-127
gb|BU986905.1|BU986905 HF13E01r HF Hordeum vulgare subsp. v... 456 e-127
gb|BU987546.1|BU987546 HF15A19r HF Hordeum vulgare subsp. v... 456 e-127
gb|BU989068.1|BU989068 HF19K19r HF Hordeum vulgare subsp. v... 456 e-127
gb|CA030399.1|CA030399 HX06P04r HX Hordeum vulgare subsp. v... 456 e-127
gb|CK122020.1|CK122020 BES1824101a07 BES1824 Hordeum vulgar... 456 e-127
gb|CK122585.1|CK122585 BES1824104h23 BES1824 Hordeum vulgar... 456 e-127
gb|CK123782.1|CK123782 BES1824105f13 BES1824 Hordeum vulgar... 456 e-127
gb|BQ764505.1|BQ764505 EBca01_SQ004_G01_R carpel, pre-anthe... 454 e-126
gb|BU997989.1|BU997989 HI09K04r HI Hordeum vulgare subsp. v... 454 e-126
gb|CA002184.1|CA002184 HS06M08r HS Hordeum vulgare subsp. v... 454 e-126
gb|BG416688.1|BG416688 HVSMEk0014C02f Hordeum vulgare testa... 452 e-126
gb|AW983365.3|AW983365 HVSMEg0010F21f Hordeum vulgare pre-a... 452 e-126
gb|CA030671.1|CA030671 HX07M09r HX Hordeum vulgare subsp. v... 450 e-125
gb|BG343596.2|BG343596 HVSMEg0006H20f Hordeum vulgare pre-a... 448 e-124
gb|AV915405.1|AV915405 AV915405 K. Sato unpublished cDNA li... 448 e-124
gb|AV917275.1|AV917275 AV917275 K. Sato unpublished cDNA li... 448 e-124
gb|AV919174.1|AV919174 AV919174 K. Sato unpublished cDNA li... 448 e-124
gb|AV920492.1|AV920492 AV920492 K. Sato unpublished cDNA li... 448 e-124
gb|AV921933.1|AV921933 AV921933 K. Sato unpublished cDNA li... 448 e-124
gb|AV922446.1|AV922446 AV922446 K. Sato unpublished cDNA li... 448 e-124
gb|BJ466256.1|BJ466256 BJ466256 K. Sato unpublished cDNA li... 448 e-124
gb|AV914316.1|AV914316 AV914316 K. Sato unpublished cDNA li... 446 e-124
gb|AV916643.1|AV916643 AV916643 K. Sato unpublished cDNA li... 446 e-124
gb|AV919343.1|AV919343 AV919343 K. Sato unpublished cDNA li... 446 e-124
gb|BQ458678.1|BQ458678 HA04I09r HA Hordeum vulgare subsp. v... 446 e-124
gb|BQ459572.1|BQ459572 HA08L16r HA Hordeum vulgare subsp. v... 446 e-124
gb|BQ459876.1|BQ459876 HA07N08r HA Hordeum vulgare subsp. v... 446 e-124
gb|BQ460655.1|BQ460655 HA06E24r HA Hordeum vulgare subsp. v... 446 e-124
gb|BQ656426.1|BQ656426 HA04I09u HA Hordeum vulgare subsp. v... 446 e-124
gb|BM375051.2|BM375051 EBem06_SQ002_D02_R embryo, 21 DPA, n... 446 e-124
gb|BM373234.2|BM373234 EBma04_SQ003_K07_R maternal, 10 DPA,... 446 e-124
gb|BM371448.2|BM371448 EBma08_SQ002_M08_R maternal, 28 DPA,... 446 e-124
gb|BM100839.2|BM100839 EBpi01_SQ002_C09_R pistil, 1 DPA, no... 446 e-124
gb|BM101033.2|BM101033 EBpi01_SQ002_K10_R pistil, 1 DPA, no... 446 e-124
gb|BU981814.1|BU981814 HA24L12r HA Hordeum vulgare subsp. v... 446 e-124
gb|CA012538.1|CA012538 HT05L10r HT Hordeum vulgare subsp. v... 446 e-124
gb|CA013768.1|CA013768 HT09G21r HT Hordeum vulgare subsp. v... 446 e-124
gb|CV064263.1|CV064263 BNEL99h8 Barley EST endosperm librar... 446 e-124
gb|CK124486.1|CK124486 BES1824109f12 BES1824 Hordeum vulgar... 446 e-124
gb|AL506944.1|AL506944 AL506944 Hordeum vulgare Barke devel... 444 e-123
gb|BI953670.1|BI953670 HVSMEm0013M20f Hordeum vulgare green... 444 e-123
gb|BG416096.2|BG416096 HVSMEk0009L21f Hordeum vulgare testa... 444 e-123
gb|AV916514.1|AV916514 AV916514 K. Sato unpublished cDNA li... 444 e-123
gb|AV918040.1|AV918040 AV918040 K. Sato unpublished cDNA li... 444 e-123
gb|AV930746.1|AV930746 AV930746 K. Sato unpublished cDNA li... 444 e-123
gb|BM373265.2|BM373265 EBma04_SQ003_M09_R maternal, 10 DPA,... 444 e-123
gb|BU967063.1|BU967063 HB03C22r BC Hordeum vulgare subsp. v... 444 e-123
gb|AL507569.1|AL507569 AL507569 Hordeum vulgare Barke devel... 442 e-123
gb|AL510857.1|AL510857 AL510857 Hordeum vulgare Barke devel... 442 e-123
gb|BF254574.3|BF254574 HVSMEf0004G12f Hordeum vulgare seedl... 442 e-123
gb|AW983325.3|AW983325 HVSMEg0010D14f Hordeum vulgare pre-a... 442 e-123
gb|AV912739.1|AV912739 AV912739 K. Sato unpublished cDNA li... 442 e-123
gb|AV917474.1|AV917474 AV917474 K. Sato unpublished cDNA li... 442 e-123
gb|BJ462748.1|BJ462748 BJ462748 K. Sato unpublished cDNA li... 442 e-123
gb|BJ465577.1|BJ465577 BJ465577 K. Sato unpublished cDNA li... 442 e-123
gb|BJ467420.1|BJ467420 BJ467420 K. Sato unpublished cDNA li... 442 e-123
gb|BQ459084.1|BQ459084 HA02G02r HA Hordeum vulgare subsp. v... 442 e-123
gb|BM376971.2|BM376971 EBem05_SQ003_M01_R embryo, 14 DPA, n... 442 e-123
gb|BQ754531.1|BQ754531 EBed01_SQ003_B01_R endosperm, 6 DPA,... 442 e-123
gb|BU977304.1|BU977304 HA11D04r HA Hordeum vulgare subsp. v... 442 e-123
gb|BU981849.1|BU981849 HA24N02r HA Hordeum vulgare subsp. v... 442 e-123
gb|BU983258.1|BU983258 HA29B12r HA Hordeum vulgare subsp. v... 442 e-123
gb|CA000847.1|CA000847 HS06M08u HS Hordeum vulgare subsp. v... 442 e-123
gb|CA005826.1|CA005826 HU08D11u HU Hordeum vulgare subsp. v... 442 e-123
gb|CA022945.1|CA022945 HZ44M21r HZ Hordeum vulgare subsp. v... 442 e-123
gb|CA029421.1|CA029421 HZ65C16r HZ Hordeum vulgare subsp. v... 442 e-123
gb|CB883155.1|CB883155 HQ01G02w HQ Hordeum vulgare subsp. v... 442 e-123
gb|CK124493.1|CK124493 BES1824109f20 BES1824 Hordeum vulgar... 442 e-123
gb|CK125415.1|CK125415 BES1824107p02 BES1824 Hordeum vulgar... 442 e-123
gb|AL505071.1|AL505071 AL505071 Hordeum vulgare Barke roots... 440 e-122
gb|BJ467308.1|BJ467308 BJ467308 K. Sato unpublished cDNA li... 440 e-122
gb|BM375868.2|BM375868 EBem06_SQ004_K08_R embryo, 21 DPA, n... 440 e-122
gb|CK122242.1|CK122242 BES1824102i08 BES1824 Hordeum vulgar... 440 e-122
gb|CK124210.1|CK124210 BES1824108a01 BES1824 Hordeum vulgar... 440 e-122
gb|CK125912.1|CK125912 BES1824111B1g03 BES1824 Hordeum vulg... 440 e-122
gb|BU980120.1|BU980120 HA18K22r HA Hordeum vulgare subsp. v... 438 e-121
gb|BG343775.2|BG343775 HVSMEg0006L13f Hordeum vulgare pre-a... 436 e-121
gb|BM099405.2|BM099405 EBes01_SQ003_C13_R embryo sac, 4-6 D... 436 e-121
gb|BI779646.2|BI779646 EBro01_SQ004_K18_R root, 3 week, hyd... 436 e-121
gb|BQ764066.1|BQ764066 EBro03_SQ006_N04_R root, 3 week, wat... 436 e-121
gb|BU979414.1|BU979414 HA16B08r HA Hordeum vulgare subsp. v... 436 e-121
gb|BU979805.1|BU979805 HA17G07r HA Hordeum vulgare subsp. v... 436 e-121
gb|BQ755113.1|BQ755113 EBed02_SQ003_M05_R endosperm, 8 DPA,... 434 e-120
gb|BU978206.1|BU978206 HA12M02r HA Hordeum vulgare subsp. v... 434 e-120
gb|BF630505.3|BF630505 HVSMEb0010K21f Hordeum vulgare seedl... 432 e-120
gb|AJ435888.1|AJ435888 AJ435888 S00002 Hordeum vulgare subs... 432 e-120
gb|BI776369.2|BI776369 EBpi05_SQ001_A06_R pistil, 8 DPA, no... 432 e-120
gb|BQ764957.1|BQ764957 EBca01_SQ005_J11_R carpel, pre-anthe... 432 e-120
gb|CK122978.1|CK122978 BES1824101k04 BES1824 Hordeum vulgar... 432 e-120
gb|BG416589.1|BG416589 HVSMEk0013E08f Hordeum vulgare testa... 430 e-119
gb|BE193550.3|BE193550 HVSMEh0081I24f Hordeum vulgare 5-45 ... 430 e-119
gb|AV924522.1|AV924522 AV924522 K. Sato unpublished cDNA li... 430 e-119
gb|AV929614.1|AV929614 AV929614 K. Sato unpublished cDNA li... 430 e-119
gb|BQ459109.1|BQ459109 HA02E09r HA Hordeum vulgare subsp. v... 430 e-119
gb|BQ470600.1|BQ470600 HX03H10r HX Hordeum vulgare subsp. v... 430 e-119
gb|BQ470850.1|BQ470850 HX04D15r HX Hordeum vulgare subsp. v... 430 e-119
gb|BQ656566.1|BQ656566 HA04A14u HA Hordeum vulgare subsp. v... 430 e-119
gb|BM368166.2|BM368166 EBed01_SQ002_F19_R endosperm, 6 DPA,... 430 e-119
gb|BI776358.2|BI776358 EBem04_SQ001_N03_R embryo, 12 DPA, n... 430 e-119
gb|BM097763.2|BM097763 EBem04_SQ002_K02_R embryo, 12 DPA, n... 430 e-119
gb|BM098856.2|BM098856 EBpi05_SQ002_E06_R pistil, 8 DPA, no... 430 e-119
gb|BQ754295.1|BQ754295 EBca01_SQ003_H15_R carpel, pre-anthe... 430 e-119
gb|BQ760683.1|BQ760683 EBro03_SQ003_C24_R root, 3 week, wat... 430 e-119
gb|BQ764686.1|BQ764686 EBca01_SQ004_I14_R carpel, pre-anthe... 430 e-119
gb|BU976315.1|BU976315 HA03I03r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU976316.1|BU976316 HA03I03u HA Hordeum vulgare subsp. v... 430 e-119
gb|BU981034.1|BU981034 HA22H03r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU982625.1|BU982625 HA27B22r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU983277.1|BU983277 HA29C16r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU983310.1|BU983310 HA29E12r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU983330.1|BU983330 HA29G01r HA Hordeum vulgare subsp. v... 430 e-119
gb|BU997379.1|BU997379 HI07M23r HI Hordeum vulgare subsp. v... 430 e-119
gb|CA018550.1|CA018550 HV08P05r HV Hordeum vulgare subsp. v... 430 e-119
gb|CA022981.1|CA022981 HZ44O12r HZ Hordeum vulgare subsp. v... 430 e-119
gb|CA023153.1|CA023153 HZ45G05r HZ Hordeum vulgare subsp. v... 430 e-119
gb|CA024093.1|CA024093 HZ48F12r HZ Hordeum vulgare subsp. v... 430 e-119
gb|CA029767.1|CA029767 HX05C14r HX Hordeum vulgare subsp. v... 430 e-119
gb|CA032407.1|CA032407 HX12P03r HX Hordeum vulgare subsp. v... 430 e-119
gb|CB874401.1|CB874401 HX05C14w HX Hordeum vulgare subsp. v... 430 e-119
gb|CB874991.1|CB874991 HX06P04w HX Hordeum vulgare subsp. v... 430 e-119
gb|CB875265.1|CB875265 HX07M09w HX Hordeum vulgare subsp. v... 430 e-119
gb|CK122982.1|CK122982 BES1824101k09 BES1824 Hordeum vulgar... 430 e-119
gb|BE196238.2|BE196238 HVSMEh0091L22f Hordeum vulgare 5-45 ... 428 e-118
gb|BE455138.2|BE455138 HVSMEh0096F12f Hordeum vulgare 5-45 ... 428 e-118
gb|BI947588.1|BI947588 HVSMEl0006A05f Hordeum vulgare spike... 428 e-118
gb|BI948327.1|BI948327 HVSMEl0009A20f Hordeum vulgare spike... 428 e-118
gb|BF628488.3|BF628488 HVSMEb0006E02f Hordeum vulgare seedl... 428 e-118
gb|BG343408.2|BG343408 HVSMEg0005K20f Hordeum vulgare pre-a... 428 e-118
gb|BG418228.2|BG418228 HVSMEk0021P20f Hordeum vulgare testa... 428 e-118
gb|AV917222.1|AV917222 AV917222 K. Sato unpublished cDNA li... 428 e-118
gb|AV918558.1|AV918558 AV918558 K. Sato unpublished cDNA li... 428 e-118
gb|AV922389.1|AV922389 AV922389 K. Sato unpublished cDNA li... 428 e-118
gb|BJ466929.1|BJ466929 BJ466929 K. Sato unpublished cDNA li... 428 e-118
gb|BQ458323.1|BQ458323 HA05I21r HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ459823.1|BQ459823 HA07P18r HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ459827.1|BQ459827 HA07P10r HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ460241.1|BQ460241 HA06N13r HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ471248.1|BQ471248 HV01N05T HV Hordeum vulgare subsp. v... 428 e-118
gb|BQ657275.1|BQ657275 HA08P19u HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ657367.1|BQ657367 HA08K08u HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ657532.1|BQ657532 HA07P18u HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ657539.1|BQ657539 HA07P10u HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ658137.1|BQ658137 HA05I21u HA Hordeum vulgare subsp. v... 428 e-118
gb|BQ664103.1|BQ664103 HV01N05w HV Hordeum vulgare subsp. v... 428 e-118
gb|BM097585.2|BM097585 EBem04_SQ002_C02_R embryo, 12 DPA, n... 428 e-118
gb|BM374169.2|BM374169 EBma03_SQ003_N14_R maternal, 8 DPA, ... 428 e-118
gb|BM098078.2|BM098078 EBpi03_SQ002_H22_R pistil, 4 DPA, no... 428 e-118
gb|BU976198.1|BU976198 HA03F02u HA Hordeum vulgare subsp. v... 428 e-118
gb|BU976748.1|BU976748 HA10D19r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU976749.1|BU976749 HA10D19u HA Hordeum vulgare subsp. v... 428 e-118
gb|BU976788.1|BU976788 HA10F02r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU976789.1|BU976789 HA10F02u HA Hordeum vulgare subsp. v... 428 e-118
gb|BU980664.1|BU980664 HA21F06r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU980695.1|BU980695 HA21G17r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU982257.1|BU982257 HA25P17r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU982790.1|BU982790 HA27J22r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU983143.1|BU983143 HA28L04r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU983503.1|BU983503 HA29P06r HA Hordeum vulgare subsp. v... 428 e-118
gb|BU990545.1|BU990545 HF25F23r HF Hordeum vulgare subsp. v... 428 e-118
gb|BU994835.1|BU994835 HM08F18r HM Hordeum vulgare subsp. v... 428 e-118
gb|BU997068.1|BU997068 HI06M24r HI Hordeum vulgare subsp. v... 428 e-118
gb|CA020496.1|CA020496 HZ36H20r HZ Hordeum vulgare subsp. v... 428 e-118
gb|CA020546.1|CA020546 HZ36K04r HZ Hordeum vulgare subsp. v... 428 e-118
gb|CA026426.1|CA026426 HZ55O04r HZ Hordeum vulgare subsp. v... 428 e-118
gb|CA027857.1|CA027857 HZ60D23r HZ Hordeum vulgare subsp. v... 428 e-118
gb|CA029446.1|CA029446 HZ65D21r HZ Hordeum vulgare subsp. v... 428 e-118
gb|CA032038.1|CA032038 HX11N07r HX Hordeum vulgare subsp. v... 428 e-118
gb|CA032781.1|CA032781 HX14D01r HX Hordeum vulgare subsp. v... 428 e-118
gb|CA032926.1|CA032926 HX14J17r HX Hordeum vulgare subsp. v... 428 e-118
gb|CB858383.1|CB858383 HI06M24w HI Hordeum vulgare subsp. v... 428 e-118
gb|CB876616.1|CB876616 HX11N07w HX Hordeum vulgare subsp. v... 428 e-118
gb|CB880962.1|CB880962 HM08F18w HM Hordeum vulgare subsp. v... 428 e-118
gb|CK122018.1|CK122018 BES1824101a04 BES1824 Hordeum vulgar... 428 e-118
gb|CK122360.1|CK122360 BES1824103a02 BES1824 Hordeum vulgar... 428 e-118
gb|CK122845.1|CK122845 BES1824106c24 BES1824 Hordeum vulgar... 428 e-118
gb|CK122974.1|CK122974 BES1824101j23 BES1824 Hordeum vulgar... 428 e-118
gb|CK123107.1|CK123107 BES1824102b23 BES1824 Hordeum vulgar... 428 e-118
gb|CK123695.1|CK123695 BES1824105b21 BES1824 Hordeum vulgar... 428 e-118
gb|CK125773.1|CK125773 BES1824110m05 BES1824 Hordeum vulgar... 428 e-118
gb|AL506541.1|AL506541 AL506541 Hordeum vulgare Barke devel... 426 e-118
gb|AL508344.1|AL508344 AL508344 Hordeum vulgare Barke devel... 426 e-118
gb|BI950640.1|BI950640 HVSMEl0021N20f Hordeum vulgare spike... 426 e-118
gb|BF258396.3|BF258396 HVSMEf0015J20f Hordeum vulgare seedl... 426 e-118
gb|AV913264.1|AV913264 AV913264 K. Sato unpublished cDNA li... 426 e-118
gb|AJ462183.1|AJ462183 AJ462183 S00002 Hordeum vulgare subs... 426 e-118
gb|BJ466209.1|BJ466209 BJ466209 K. Sato unpublished cDNA li... 426 e-118
gb|BQ460424.1|BQ460424 HA09L01r HA Hordeum vulgare subsp. v... 426 e-118
gb|BQ470847.1|BQ470847 HX04D12r HX Hordeum vulgare subsp. v... 426 e-118
gb|BQ471006.1|BQ471006 HX04L02r HX Hordeum vulgare subsp. v... 426 e-118
gb|BQ472067.1|BQ472067 HV04F01r HV Hordeum vulgare subsp. v... 426 e-118
gb|BQ664866.1|BQ664866 HX01C21w HX Hordeum vulgare subsp. v... 426 e-118
gb|BM097850.2|BM097850 EBem04_SQ002_O03_R embryo, 12 DPA, n... 426 e-118
gb|BM377820.2|BM377820 EBem04_SQ004_E12_R embryo, 12 DPA, n... 426 e-118
gb|BM377906.2|BM377906 EBem04_SQ004_I18_R embryo, 12 DPA, n... 426 e-118
gb|BM376758.2|BM376758 EBem05_SQ003_C12_R embryo, 14 DPA, n... 426 e-118
gb|BI780639.2|BI780639 EBes01_SQ001_J08_R embryo sac, 4-6 D... 426 e-118
gb|BM101469.2|BM101469 EBpi01_SQ003_P03_R pistil, 1 DPA, no... 426 e-118
gb|BM370933.2|BM370933 EBro04_SQ002_O10_R root, 3 week, sal... 426 e-118
gb|BM370960.2|BM370960 EBro04_SQ003_A21_R root, 3 week, sal... 426 e-118
gb|BQ767796.1|BQ767796 EBro08_SQ009_J20_R root, 3 week, dro... 426 e-118
gb|BQ768784.1|BQ768784 EBro08_SQ012_K15_R root, 3 week, dro... 426 e-118
gb|BU976733.1|BU976733 HA10D09r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU977521.1|BU977521 HA11J02r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU980042.1|BU980042 HA18F23r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU980079.1|BU980079 HA18H13r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU980167.1|BU980167 HA18O02r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU980421.1|BU980421 HA20J18r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU981505.1|BU981505 HA23N09r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU984017.1|BU984017 HA31L21r HA Hordeum vulgare subsp. v... 426 e-118
gb|BU984322.1|BU984322 HF03J20r HF Hordeum vulgare subsp. v... 426 e-118
gb|BU984750.1|BU984750 HF04O11r HF Hordeum vulgare subsp. v... 426 e-118
gb|BU985218.1|BU985218 HF06H22r HF Hordeum vulgare subsp. v... 426 e-118
gb|BU998919.1|BU998919 HI12J03r HI Hordeum vulgare subsp. v... 426 e-118
gb|BU999705.1|BU999705 HI15H01r HI Hordeum vulgare subsp. v... 426 e-118
gb|CA016652.1|CA016652 HV08C22u HV Hordeum vulgare subsp. v... 426 e-118
gb|CA018287.1|CA018287 HV08C22r HV Hordeum vulgare subsp. v... 426 e-118
gb|CA022379.1|CA022379 HZ42P03r HZ Hordeum vulgare subsp. v... 426 e-118
gb|CA029923.1|CA029923 HX05J11r HX Hordeum vulgare subsp. v... 426 e-118
gb|CA030835.1|CA030835 HX08E10r HX Hordeum vulgare subsp. v... 426 e-118
gb|CA030944.1|CA030944 HX08J09r HX Hordeum vulgare subsp. v... 426 e-118
gb|CA031816.1|CA031816 HX11D11r HX Hordeum vulgare subsp. v... 426 e-118
gb|CA032385.1|CA032385 HX12O02r HX Hordeum vulgare subsp. v... 426 e-118
gb|CA032933.1|CA032933 HX14K02r HX Hordeum vulgare subsp. v... 426 e-118
gb|CB860078.1|CB860078 HI12J03w HI Hordeum vulgare subsp. v... 426 e-118
gb|CB874544.1|CB874544 HX05J11w HX Hordeum vulgare subsp. v... 426 e-118
gb|CB875427.1|CB875427 HX08E10w HX Hordeum vulgare subsp. v... 426 e-118
gb|CB875527.1|CB875527 HX08J09w HX Hordeum vulgare subsp. v... 426 e-118
gb|CB875741.1|CB875741 HX09D14w HX Hordeum vulgare subsp. v... 426 e-118
gb|CK122902.1|CK122902 BES1824101c18 BES1824 Hordeum vulgar... 426 e-118
gb|CK124114.1|CK124114 BES1824107b22 BES1824 Hordeum vulgar... 426 e-118
gb|CK124897.1|CK124897 BES1824110p07 BES1824 Hordeum vulgar... 426 e-118
gb|CK124903.1|CK124903 BES1824110p13 BES1824 Hordeum vulgar... 426 e-118
gb|CK125127.1|CK125127 BES1824106m11 BES1824 Hordeum vulgar... 426 e-118
gb|AL507903.1|AL507903 AL507903 Hordeum vulgare Barke devel... 424 e-117
gb|AL508270.1|AL508270 AL508270 Hordeum vulgare Barke devel... 424 e-117
gb|AL511160.1|AL511160 AL511160 Hordeum vulgare Barke devel... 424 e-117
gb|BG343651.2|BG343651 HVSMEg0006C04f Hordeum vulgare pre-a... 424 e-117
gb|BG414201.2|BG414201 HVSMEk0001C03f Hordeum vulgare testa... 424 e-117
gb|AV913864.1|AV913864 AV913864 K. Sato unpublished cDNA li... 424 e-117
gb|AV914483.1|AV914483 AV914483 K. Sato unpublished cDNA li... 424 e-117
gb|AV916683.1|AV916683 AV916683 K. Sato unpublished cDNA li... 424 e-117
gb|AV919541.1|AV919541 AV919541 K. Sato unpublished cDNA li... 424 e-117
gb|AV921478.1|AV921478 AV921478 K. Sato unpublished cDNA li... 424 e-117
gb|AV921976.1|AV921976 AV921976 K. Sato unpublished cDNA li... 424 e-117
gb|BJ467216.1|BJ467216 BJ467216 K. Sato unpublished cDNA li... 424 e-117
gb|BQ458432.1|BQ458432 HA05D21r HA Hordeum vulgare subsp. v... 424 e-117
gb|BQ459568.1|BQ459568 HA08L24r HA Hordeum vulgare subsp. v... 424 e-117
gb|BQ463572.1|BQ463572 HI05L22r HI Hordeum vulgare subsp. v... 424 e-117
gb|BQ464515.1|BQ464515 HF02I01r HF Hordeum vulgare subsp. v... 424 e-117
gb|BQ470265.1|BQ470265 HX02F17r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ470361.1|BQ470361 HX02L10r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ470644.1|BQ470644 HX03J14r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ470663.1|BQ470663 HX03K10r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ470808.1|BQ470808 HX04B15r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ470872.1|BQ470872 HX04E19r HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ471610.1|BQ471610 HV02P02r HV Hordeum vulgare subsp. v... 424 e-117
gb|BQ665012.1|BQ665012 HX01M15w HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ665148.1|BQ665148 HX02F02u HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ665242.1|BQ665242 HX02L10u HX Hordeum vulgare subsp. v... 424 e-117
gb|BQ665546.1|BQ665546 HX04B15u HX Hordeum vulgare subsp. v... 424 e-117
gb|BM377844.2|BM377844 EBem04_SQ004_F15_R embryo, 12 DPA, n... 424 e-117
gb|BM377940.2|BM377940 EBem04_SQ004_K13_R embryo, 12 DPA, n... 424 e-117
gb|BM375238.2|BM375238 EBem06_SQ002_M05_R embryo, 21 DPA, n... 424 e-117
gb|BM374238.2|BM374238 EBpi03_SQ003_A24_R pistil, 4 DPA, no... 424 e-117
gb|BI778651.2|BI778651 EBro07_SQ003_O17_R root, 3 week, red... 424 e-117
gb|BU976260.1|BU976260 HA03G17r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU976261.1|BU976261 HA03G17u HA Hordeum vulgare subsp. v... 424 e-117
gb|BU976476.1|BU976476 HA03M08r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977085.1|BU977085 HA10N05r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977429.1|BU977429 HA11G15r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977515.1|BU977515 HA11I22r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977576.1|BU977576 HA11K15r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977623.1|BU977623 HA11M03r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU977762.1|BU977762 HA11P19r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU978339.1|BU978339 HA12P10r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU978648.1|BU978648 HA13N17r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU979364.1|BU979364 HA15O21r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU979873.1|BU979873 HA17K11r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU982152.1|BU982152 HA25K18r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU982782.1|BU982782 HA27J14r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU984074.1|BU984074 HA31O16r HA Hordeum vulgare subsp. v... 424 e-117
gb|BU988077.1|BU988077 HF16J14r HF Hordeum vulgare subsp. v... 424 e-117
gb|BU989705.1|BU989705 HF22H13r HF Hordeum vulgare subsp. v... 424 e-117
gb|BU998245.1|BU998245 HI10H05r HI Hordeum vulgare subsp. v... 424 e-117
gb|BU998983.1|BU998983 HI12N01r HI Hordeum vulgare subsp. v... 424 e-117
gb|BU999112.1|BU999112 HI13E20r HI Hordeum vulgare subsp. v... 424 e-117
gb|CA020770.1|CA020770 HZ37K14r HZ Hordeum vulgare subsp. v... 424 e-117
gb|CA022781.1|CA022781 HZ44F11r HZ Hordeum vulgare subsp. v... 424 e-117
gb|CA025788.1|CA025788 HZ53C09r HZ Hordeum vulgare subsp. v... 424 e-117
gb|CA026432.1|CA026432 HZ55O12r HZ Hordeum vulgare subsp. v... 424 e-117
gb|CA027454.1|CA027454 HZ58P15r HZ Hordeum vulgare subsp. v... 424 e-117
gb|CA029909.1|CA029909 HX05I20r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA030274.1|CA030274 HX06J09r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA030985.1|CA030985 HX08L03r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA030988.1|CA030988 HX08L06r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA031231.1|CA031231 HX09F24r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA031236.1|CA031236 HX09G05r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA031627.1|CA031627 HX10K04r HX Hordeum vulgare subsp. v... 424 e-117
gb|CA032945.1|CA032945 HX14K17r HX Hordeum vulgare subsp. v... 424 e-117
gb|CB859437.1|CB859437 HI10H05w HI Hordeum vulgare subsp. v... 424 e-117
gb|CB860148.1|CB860148 HI12N01w HI Hordeum vulgare subsp. v... 424 e-117
gb|CB874875.1|CB874875 HX06J09w HX Hordeum vulgare subsp. v... 424 e-117
gb|CB875567.1|CB875567 HX08L03w HX Hordeum vulgare subsp. v... 424 e-117
gb|CB875569.1|CB875569 HX08L06w HX Hordeum vulgare subsp. v... 424 e-117
gb|CB875796.1|CB875796 HX09F24w HX Hordeum vulgare subsp. v... 424 e-117
gb|CB875800.1|CB875800 HX09G05w HX Hordeum vulgare subsp. v... 424 e-117
gb|CV061223.1|CV061223 BNEL66c9 Barley EST endosperm librar... 424 e-117
gb|CV063882.1|CV063882 BNEL94c10 Barley EST endosperm libra... 424 e-117
gb|CK122795.1|CK122795 BES1824105p22 BES1824 Hordeum vulgar... 424 e-117
gb|CK123458.1|CK123458 BES1824104b19 BES1824 Hordeum vulgar... 424 e-117
gb|CK123930.1|CK123930 BES1824106d14 BES1824 Hordeum vulgar... 424 e-117
gb|CK124761.1|CK124761 BES1824110f02 BES1824 Hordeum vulgar... 424 e-117
gb|CK125093.1|CK125093 BES1824106l01 BES1824 Hordeum vulgar... 424 e-117
gb|AL503088.1|AL503088 AL503088 Hordeum vulgare Barke roots... 422 e-117
gb|AL509974.1|AL509974 AL509974 Hordeum vulgare Barke devel... 422 e-117
gb|AV914069.1|AV914069 AV914069 K. Sato unpublished cDNA li... 422 e-117
gb|AV918699.1|AV918699 AV918699 K. Sato unpublished cDNA li... 422 e-117
gb|AV919107.1|AV919107 AV919107 K. Sato unpublished cDNA li... 422 e-117
gb|AJ434597.1|AJ434597 AJ434597 S00002 Hordeum vulgare subs... 422 e-117
gb|BJ463181.1|BJ463181 BJ463181 K. Sato unpublished cDNA li... 422 e-117
gb|BQ470104.1|BQ470104 HX01M15T HX Hordeum vulgare subsp. v... 422 e-117
gb|BU977605.1|BU977605 HA11L14u HA Hordeum vulgare subsp. v... 422 e-117
gb|BU980154.1|BU980154 HA18N05r HA Hordeum vulgare subsp. v... 422 e-117
gb|BU983201.1|BU983201 HA28O02r HA Hordeum vulgare subsp. v... 422 e-117
gb|BU988718.1|BU988718 HF18H20r HF Hordeum vulgare subsp. v... 422 e-117
gb|CV054620.1|CV054620 BNEL111e11 Barley EST endosperm libr... 422 e-117
gb|AW982513.3|AW982513 HVSMEg0003H13f Hordeum vulgare pre-a... 420 e-116
gb|BG344489.2|BG344489 HVSMEg0009G18f Hordeum vulgare pre-a... 420 e-116
gb|AV924489.1|AV924489 AV924489 K. Sato unpublished cDNA li... 420 e-116
gb|AJ432104.1|AJ432104 AJ432104 S00002 Hordeum vulgare subs... 420 e-116
gb|BQ458704.1|BQ458704 HA04H06r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ458957.1|BQ458957 HA02L22r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ459072.1|BQ459072 HA02G16r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ459318.1|BQ459318 HA01I05r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ460371.1|BQ460371 HA09O09r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ460409.1|BQ460409 HA09L12r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ460612.1|BQ460612 HA06H11r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ460708.1|BQ460708 HA06C20r HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ463025.1|BQ463025 HI02M18r HI Hordeum vulgare subsp. v... 420 e-116
gb|BQ464453.1|BQ464453 HF02F07r HF Hordeum vulgare subsp. v... 420 e-116
gb|BQ469682.1|BQ469682 HZ01I20r HZ Hordeum vulgare subsp. v... 420 e-116
gb|BQ470423.1|BQ470423 HX02P01r HX Hordeum vulgare subsp. v... 420 e-116
gb|BQ470653.1|BQ470653 HX03J23r HX Hordeum vulgare subsp. v... 420 e-116
gb|BQ470680.1|BQ470680 HX03L04r HX Hordeum vulgare subsp. v... 420 e-116
gb|BQ471010.1|BQ471010 HX04L06r HX Hordeum vulgare subsp. v... 420 e-116
gb|BQ656308.1|BQ656308 HA04P18u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ656641.1|BQ656641 HA02L22u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ656653.1|BQ656653 HA02L01u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ656926.1|BQ656926 HA01H13u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ656931.1|BQ656931 HA01G20u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ657914.1|BQ657914 HA06H11u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ657984.1|BQ657984 HA06C20u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ658125.1|BQ658125 HA05J24u HA Hordeum vulgare subsp. v... 420 e-116
gb|BQ665300.1|BQ665300 HX02P01u HX Hordeum vulgare subsp. v... 420 e-116
gb|BQ665440.1|BQ665440 HX03J23u HX Hordeum vulgare subsp. v... 420 e-116
gb|BM097546.2|BM097546 EBem04_SQ001_P09_R embryo, 12 DPA, n... 420 e-116
gb|BM097600.2|BM097600 EBem04_SQ002_C18_R embryo, 12 DPA, n... 420 e-116
gb|BM377400.2|BM377400 EBem04_SQ003_A09_R embryo, 12 DPA, n... 420 e-116
gb|BM377104.2|BM377104 EBem05_SQ004_C07_R embryo, 14 DPA, n... 420 e-116
gb|BM369409.2|BM369409 EBem07_SQ003_I01_R embryo, 28 DPA, n... 420 e-116
gb|BM369552.2|BM369552 EBem07_SQ003_O23_R embryo, 28 DPA, n... 420 e-116
gb|BM368469.2|BM368469 EBem08_SQ002_G09_R embryo, 40 DPA, n... 420 e-116
gb|BM376204.2|BM376204 EBma01_SQ002_K14_R maternal, 4 DPA, ... 420 e-116
gb|BM372981.2|BM372981 EBma04_SQ002_K04_R maternal, 10 DPA,... 420 e-116
gb|BQ762302.1|BQ762302 EBro01_SQ005_M07 _R root, 3 week, hy... 420 e-116
gb|BQ764045.1|BQ764045 EBro03_SQ006_J03_R root, 3 week, wat... 420 e-116
gb|BU968833.1|BU968833 HB08L16r BC Hordeum vulgare subsp. v... 420 e-116
gb|BU976059.1|BU976059 HA03B03r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU976782.1|BU976782 HA10E21r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU977488.1|BU977488 HA11I06r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU977489.1|BU977489 HA11I06u HA Hordeum vulgare subsp. v... 420 e-116
gb|BU978961.1|BU978961 HA14M07r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU979689.1|BU979689 HA16P04r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU980385.1|BU980385 HA20I06r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU983289.1|BU983289 HA29D05r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU983430.1|BU983430 HA29L09r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU983508.1|BU983508 HA29P11r HA Hordeum vulgare subsp. v... 420 e-116
gb|BU987448.1|BU987448 HF14M14r HF Hordeum vulgare subsp. v... 420 e-116
gb|BU989076.1|BU989076 HF19L03r HF Hordeum vulgare subsp. v... 420 e-116
gb|BU997451.1|BU997451 HI08A13r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU997943.1|BU997943 HI09H22r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU997963.1|BU997963 HI09I21r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU998730.1|BU998730 HI11P23r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU998753.1|BU998753 HI12B02r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU998979.1|BU998979 HI12M21r HI Hordeum vulgare subsp. v... 420 e-116
gb|BU999505.1|BU999505 HI14L12r HI Hordeum vulgare subsp. v... 420 e-116
gb|CA009686.1|CA009686 HU14N07r HU Hordeum vulgare subsp. v... 420 e-116
gb|CA016942.1|CA016942 HV05L04u HV Hordeum vulgare subsp. v... 420 e-116
gb|CA017608.1|CA017608 HV05L04r HV Hordeum vulgare subsp. v... 420 e-116
gb|CA024571.1|CA024571 HZ49K24r HZ Hordeum vulgare subsp. v... 420 e-116
gb|CA026603.1|CA026603 HZ56G05r HZ Hordeum vulgare subsp. v... 420 e-116
gb|CA028384.1|CA028384 HZ61N03r HZ Hordeum vulgare subsp. v... 420 e-116
gb|CA028683.1|CA028683 HZ62O15r HZ Hordeum vulgare subsp. v... 420 e-116
gb|CA030969.1|CA030969 HX08K11r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA031459.1|CA031459 HX10A11r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA031585.1|CA031585 HX10G22r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA031751.1|CA031751 HX11A11r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA032080.1|CA032080 HX11P06r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA032478.1|CA032478 HX13C20r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA032666.1|CA032666 HX13N08r HX Hordeum vulgare subsp. v... 420 e-116
gb|CA032869.1|CA032869 HX14G23r HX Hordeum vulgare subsp. v... 420 e-116
gb|BJ549089.1|BJ549089 BJ549089 K. Sato unpublished cDNA li... 420 e-116
gb|BJ549692.1|BJ549692 BJ549692 K. Sato unpublished cDNA li... 420 e-116
gb|CB858696.1|CB858696 HI08A13w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB859143.1|CB859143 HI09H22w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB859163.1|CB859163 HI09I21w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB859915.1|CB859915 HI11P23w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB859938.1|CB859938 HI12B02w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB860144.1|CB860144 HI12M21w HI Hordeum vulgare subsp. v... 420 e-116
gb|CB875552.1|CB875552 HX08K11w HX Hordeum vulgare subsp. v... 420 e-116
gb|CB876195.1|CB876195 HX10J03w HX Hordeum vulgare subsp. v... 420 e-116
gb|CB876333.1|CB876333 HX10P14w HX Hordeum vulgare subsp. v... 420 e-116
gb|CB876354.1|CB876354 HX11A11w HX Hordeum vulgare subsp. v... 420 e-116
gb|CB876656.1|CB876656 HX11P06w HX Hordeum vulgare subsp. v... 420 e-116
gb|CV054416.1|CV054416 BNEL10C5 Barley EST endosperm librar... 420 e-116
gb|CV056751.1|CV056751 BNEL20c1 Barley EST endosperm librar... 420 e-116
gb|CV057640.1|CV057640 BNEL2B12 Barley EST endosperm librar... 420 e-116
gb|CV058136.1|CV058136 BNEL34g11 Barley EST endosperm libra... 420 e-116
gb|CV059558.1|CV059558 BNEL49d8 Barley EST endosperm librar... 420 e-116
>gb|BM376670.2|BM376670 EBem05_SQ002_O03_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ002_O03 5', mRNA sequence
Length = 580
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 514 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 455
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 454 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 395
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 394 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 335
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 275
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 274 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 215
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 214 ttgcccttcttctcgccgccgtccttgcc 186
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 110 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 58
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 131 ggccttctccgccgtcggctcctcctccgcgggcttcttc 92
>gb|BM375871.2|BM375871 EBem06_SQ004_K11_R embryo, 21 DPA, no treatment, cv Optic, EBem06
Hordeum vulgare subsp. vulgare cDNA clone
EBem06_SQ004_K11 5', mRNA sequence
Length = 534
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 522 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 463
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 462 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 403
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 402 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 343
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 342 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 283
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 282 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 223
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 222 ttgcccttcttctcgccgccgtccttgcc 194
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 118 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 66
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 139 ggccttctccgccgtcggctcctcctccgcgggcttcttc 100
>gb|BM374033.2|BM374033 EBma03_SQ003_H07_R maternal, 8 DPA, no treatment, cv Optic, EBma03
Hordeum vulgare subsp. vulgare cDNA clone
EBma03_SQ003_H07 5', mRNA sequence
Length = 588
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 522 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 463
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 462 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 403
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 402 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 343
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 342 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 283
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 282 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 223
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 222 ttgcccttcttctcgccgccgtccttgcc 194
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 118 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 66
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 139 ggccttctccgccgtcggctcctcctccgcgggcttcttc 100
>gb|BU978977.1|BU978977 HA14M24r HA Hordeum vulgare subsp. vulgare cDNA clone HA14M24
5-PRIME, mRNA sequence
Length = 643
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 536 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 477
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 476 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 417
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 416 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 357
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 356 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 297
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 296 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 237
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 236 ttgcccttcttctcgccgccgtccttgcc 208
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 132 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 80
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 153 ggccttctccgccgtcggctcctcctccgcgggcttcttc 114
>gb|BU982853.1|BU982853 HA27M23r HA Hordeum vulgare subsp. vulgare cDNA clone HA27M23
5-PRIME, mRNA sequence
Length = 556
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 534 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 475
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 474 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 415
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 414 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 355
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 354 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 295
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 294 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 235
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 234 ttgcccttcttctcgccgccgtccttgcc 206
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 130 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 78
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 151 ggccttctccgccgtcggctcctcctccgcgggcttcttc 112
>gb|CA031769.1|CA031769 HX11B09r HX Hordeum vulgare subsp. vulgare cDNA clone HX11B09
5-PRIME, mRNA sequence
Length = 561
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 357 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 298
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 297 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 238
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 237 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 178
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 177 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 118
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 117 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 58
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 57 ttgcccttcttctcgccgccgtccttgcc 29
>gb|CK123061.1|CK123061 BES1824101p23 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010P231 5-PRIME, mRNA sequence
Length = 739
Score = 486 bits (245), Expect = e-136
Identities = 308/329 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 514 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 455
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 454 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 395
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 394 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 335
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 275
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 274 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 215
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 214 ttgcccttcttctcgccgccgtccttgcc 186
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 110 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 58
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 131 ggccttctccgccgtcggctcctcctccgcgggcttcttc 92
>gb|AL507937.1|AL507937 AL507937 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY07E20V 5',
mRNA sequence
Length = 562
Score = 480 bits (242), Expect = e-134
Identities = 307/329 (93%)
Strand = Plus / Plus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 102 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 161
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 162 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 221
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||
Sbjct: 222 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaanatgtcg 281
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 282 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 341
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 342 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 401
Query: 612 ttccccttcttctcgccgccctccttgcc 640
|| ||||||||||||||||| ||||||||
Sbjct: 402 ttgcccttcttctcgccgccgtccttgcc 430
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 506 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 558
Score = 56.0 bits (28), Expect = 2e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 674 ggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||| ||||||||| || ||||||||||||||||
Sbjct: 485 ggccttctccgccgtcggctcctcctccgcgggcttcttc 524
>gb|BQ459604.1|BQ459604 HA08K08r HA Hordeum vulgare subsp. vulgare cDNA clone HA08K08
5-PRIME, mRNA sequence
Length = 547
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 488 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 429
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 428 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 369
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 368 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 309
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 308 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 249
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 248 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 189
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 188 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 129
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 128 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 76
>gb|BU976197.1|BU976197 HA03F02r HA Hordeum vulgare subsp. vulgare cDNA clone HA03F02
5-PRIME, mRNA sequence
Length = 529
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 483 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 424
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 423 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 364
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 363 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 304
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 303 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 244
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 243 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 184
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 183 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 124
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 123 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 71
>gb|BU978624.1|BU978624 HA13M12r HA Hordeum vulgare subsp. vulgare cDNA clone HA13M12
5-PRIME, mRNA sequence
Length = 607
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 486 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 427
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 426 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 367
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 366 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 307
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 306 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 247
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 246 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 187
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 186 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 127
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 126 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 74
>gb|BU983681.1|BU983681 HA30K05r HA Hordeum vulgare subsp. vulgare cDNA clone HA30K05
5-PRIME, mRNA sequence
Length = 538
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 488 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 429
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 428 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 369
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 368 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 309
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 308 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 249
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 248 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 189
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 188 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 129
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 128 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 76
>gb|CA024661.1|CA024661 HZ49P02r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ49P02
5-PRIME, mRNA sequence
Length = 595
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 474 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 415
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 414 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 355
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 354 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 295
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 294 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 235
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 234 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 175
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 174 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 115
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 114 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 62
>gb|CA028149.1|CA028149 HZ61C08r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ61C08
5-PRIME, mRNA sequence
Length = 593
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 476 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 417
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 416 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 357
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 356 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 297
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 296 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 237
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 236 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 177
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 176 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 117
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 116 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 64
>gb|CB883569.1|CB883569 HQ02K12w HQ Hordeum vulgare subsp. vulgare cDNA clone HQ02K12
3-PRIME, mRNA sequence
Length = 631
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 490 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 431
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 430 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 371
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 370 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 311
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 310 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 251
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 250 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 191
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 190 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 131
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 130 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 78
>gb|CV053818.1|CV053818 BNEL103e4 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL103e4 5' similar to histone H2B-6
- wheat, mRNA sequence
Length = 643
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 481 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 422
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 421 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 362
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 361 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 302
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 301 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 242
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 241 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 182
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 181 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 122
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 121 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 69
>gb|CV056345.1|CV056345 BNEL16F6 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL16F6 5' similar to histone H2B-6
- wheat, mRNA sequence
Length = 592
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 479 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 420
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 419 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 360
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 359 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 300
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 299 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 240
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 239 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 180
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 179 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 120
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 119 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 67
>gb|CV061361.1|CV061361 BNEL67h8 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL67h8 5' similar to histone H2B-6
- wheat, mRNA sequence
Length = 586
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 479 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 420
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 419 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 360
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 359 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 300
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 299 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 240
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 239 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 180
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 179 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 120
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 119 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 67
>gb|CV063444.1|CV063444 BNEL8D2 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL8D2 5' similar to histone H2B-6 - wheat,
mRNA sequence
Length = 547
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 409
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|CK122911.1|CK122911 BES1824101d03 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010D031 5-PRIME, mRNA sequence
Length = 613
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 471 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 412
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 411 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 352
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 351 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 292
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 291 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 232
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 231 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 172
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 171 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 112
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 111 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 59
>gb|CK124134.1|CK124134 BES1824107c19 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010C197 5-PRIME, mRNA sequence
Length = 638
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 480 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 421
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 420 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 361
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 360 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 301
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 300 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 241
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 240 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 181
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 180 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 121
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 120 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 68
>gb|CK124193.1|CK124193 BES1824107f18 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010F187 5-PRIME, mRNA sequence
Length = 651
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 483 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 424
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 423 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 364
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 363 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 304
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 303 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 244
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 243 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 184
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 183 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 124
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 123 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 71
>gb|CK124884.1|CK124884 BES1824110o17 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010O1710 5-PRIME, mRNA sequence
Length = 619
Score = 480 bits (242), Expect = e-134
Identities = 373/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcg 425
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BJ464995.1|BJ464995 BJ464995 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags36o05 5', mRNA sequence
Length = 581
Score = 476 bits (240), Expect = e-133
Identities = 300/320 (93%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 364 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 305
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 304 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 245
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 244 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 185
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 184 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 125
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 124 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 65
Query: 612 ttccccttcttctcgccgcc 631
|| |||||||||||||||||
Sbjct: 64 ttgcccttcttctcgccgcc 45
>gb|CB876373.1|CB876373 HX11B09w HX Hordeum vulgare subsp. vulgare cDNA clone HX11B09
3-PRIME, mRNA sequence
Length = 525
Score = 476 bits (240), Expect = e-133
Identities = 300/320 (93%)
Strand = Plus / Plus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 205 gcgatctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 264
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
||||||||||| || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 265 gcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 324
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||
Sbjct: 325 ggcttcttgttgtagcgggcgagcttggcggcctcaccggcgagcttctcgaagatgtcg 384
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct: 385 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 444
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 445 tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttcgccttcttc 504
Query: 612 ttccccttcttctcgccgcc 631
|| |||||||||||||||||
Sbjct: 505 ttgcccttcttctcgccgcc 524
>gb|CA014353.1|CA014353 HT11B21r HT Hordeum vulgare subsp. vulgare cDNA clone HT11B21
5-PRIME, mRNA sequence
Length = 588
Score = 474 bits (239), Expect = e-132
Identities = 370/413 (89%), Gaps = 3/413 (0%)
Strand = Plus / Minus
Query: 318 taagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagc 377
|||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 461 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 402
Query: 378 tcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttc 437
||||| || ||||||||||| || | |||||||||||||||||||| ||||||||||||
Sbjct: 401 tcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttc 342
Query: 438 ttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatg 497
||||||||||| ||||||||||| | |||| | || ||||||||||||||||||||||||
Sbjct: 341 ttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatg 282
Query: 498 aaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgcttg 557
||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||||||||
Sbjct: 281 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttg 222
Query: 558 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttcccc 617
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
Sbjct: 221 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttcttc 162
Query: 618 ttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcggcc 677
|| | ||||||| |||||||| |||||||||||||| ||| ||||||||||||| ||
Sbjct: 161 ttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc- 103
Query: 678 ttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 102 --ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 52
>gb|BF254096.3|BF254096 HVSMEf0003A06f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0003A06f, mRNA sequence
Length = 824
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 409
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|BM097641.2|BM097641 EBem04_SQ002_E17_R embryo, 12 DPA, no treatment, cv Optic, EBem04
Hordeum vulgare subsp. vulgare cDNA clone
EBem04_SQ002_E17 5', mRNA sequence
Length = 505
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 425
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BM100628.2|BM100628 EBma01_SQ005_M10_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ005_M10 5', mRNA sequence
Length = 606
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 468 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 409
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 408 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 349
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 348 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 289
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 288 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 229
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 228 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 169
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 168 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 109
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 108 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 56
>gb|BI778732.2|BI778732 EBro01_SQ001_E06_R root, 3 week, hydroponic grown, no treatment, cv
Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
EBro01_SQ001_E06 5', mRNA sequence
Length = 609
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 484 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 425
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 424 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 365
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 364 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 305
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 304 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 245
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 244 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 185
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 184 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 125
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 124 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 72
>gb|BQ759749.1|BQ759749 EBpi05_SQ004_D11_R pistil, 8 DPA, no treatment, cv Optic, EBpi05
Hordeum vulgare subsp. vulgare cDNA clone
EBpi05_SQ004_D11 5', mRNA sequence
Length = 612
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 470 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 411
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 410 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 351
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 350 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 291
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 290 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 231
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 230 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 171
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 170 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 111
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 110 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 58
>gb|BQ767014.1|BQ767014 EBro08_SQ007_B19_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ007_B19 5', mRNA sequence
Length = 627
Score = 472 bits (238), Expect = e-132
Identities = 372/416 (89%), Gaps = 3/416 (0%)
Strand = Plus / Minus
Query: 315 atctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcg 374
||||||||||| || |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 473 atctaagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcg 414
Query: 375 agctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggc 434
|||||||| || ||||||||||| || | |||||||||||||||||||| |||||||||
Sbjct: 413 agctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggc 354
Query: 435 ttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttg 494
|||||||||||||| ||||||||||| | |||| | || |||||||||||||||||||||
Sbjct: 353 ttcttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttg 294
Query: 495 atgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgc 554
|||||||||||||||||||||||||||||||| ||||| || ||||| ||||| ||||||
Sbjct: 293 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgc 234
Query: 555 ttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 614
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 233 ttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttc 174
Query: 615 cccttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcg 674
||| | ||||||| |||||||| |||||||||||||| ||| |||||||||||||
Sbjct: 173 ttcttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctcc 114
Query: 675 gccttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|| |||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 113 gc---ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|BQ458920.1|BQ458920 HA02N15r HA Hordeum vulgare subsp. vulgare cDNA clone HA02N15
5-PRIME, mRNA sequence
Length = 538
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|BQ657190.1|BQ657190 HA09E24u HA Hordeum vulgare subsp. vulgare cDNA clone HA09E24
3-PRIME, mRNA sequence
Length = 522
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Plus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 148 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 207
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 208 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 267
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 268 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 327
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 328 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 387
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 388 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 447
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 448 ctgcccttcttctcgccgccctccttg 474
>gb|BM097856.2|BM097856 EBem04_SQ002_O11_R embryo, 12 DPA, no treatment, cv Optic, EBem04
Hordeum vulgare subsp. vulgare cDNA clone
EBem04_SQ002_O11 5', mRNA sequence
Length = 521
Score = 466 bits (235), Expect = e-130
Identities = 369/413 (89%), Gaps = 3/413 (0%)
Strand = Plus / Minus
Query: 318 taagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagc 377
|||||||| || |||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 466 taagaggaggtgaacttggtgacggcctttgtgccctcggagacggcgtgcttggcgagc 407
Query: 378 tcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttc 437
||||| || ||||||||||| || | |||||||||||||||||||| ||||||||||||
Sbjct: 406 tcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttc 347
Query: 438 ttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatg 497
||||||||||| ||||||||||| | |||| | || ||||||||||||||||||||||||
Sbjct: 346 ttgttgtagcgcgcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatg 287
Query: 498 aaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacctgcttg 557
||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||||||||
Sbjct: 286 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttg 227
Query: 558 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttcccc 617
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
Sbjct: 226 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttcttc 167
Query: 618 ttcttctcgccgccctccttgcccggcacgcgcttctccgccctgggcttcttctcggcc 677
|| | ||||||| |||||||| |||||||||||||| ||| ||||||||||||| ||
Sbjct: 166 ttgtcggcgccgccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc- 108
Query: 678 ttctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccat 730
|||| | | | ||||| | |||||||||||||||||||||||||||||||
Sbjct: 107 --ctccacaggcttcttctccgccgcgggcttcttctcggccttgggcgccat 57
>gb|BM377645.2|BM377645 EBem04_SQ003_M03_R embryo, 12 DPA, no treatment, cv Optic, EBem04
Hordeum vulgare subsp. vulgare cDNA clone
EBem04_SQ003_M03 5', mRNA sequence
Length = 568
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 518 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 459
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 458 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 399
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 398 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 339
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 338 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 279
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 278 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 219
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 218 ctgcccttcttctcgccgccctccttg 192
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 132 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 87
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 105 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 53
>gb|BQ768768.1|BQ768768 EBro08_SQ012_M13_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ012_M13 5', mRNA sequence
Length = 521
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 517 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 458
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 457 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 398
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 397 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 338
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 337 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 278
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 277 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 218
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 217 ctgcccttcttctcgccgccctccttg 191
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 131 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 86
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 104 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 52
>gb|BU977854.1|BU977854 HA12C14r HA Hordeum vulgare subsp. vulgare cDNA clone HA12C14
5-PRIME, mRNA sequence
Length = 462
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 458 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 399
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 398 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 339
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 338 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 279
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 278 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 219
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 218 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 159
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 158 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 102
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 101 ttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|BU978804.1|BU978804 HA14F04r HA Hordeum vulgare subsp. vulgare cDNA clone HA14F04
5-PRIME, mRNA sequence
Length = 592
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 537 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 478
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 477 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 418
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 417 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 358
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 357 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 298
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 297 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 238
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 237 ctgcccttcttctcgccgccctccttg 211
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 151 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 106
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 124 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 72
>gb|BU979516.1|BU979516 HA16G16r HA Hordeum vulgare subsp. vulgare cDNA clone HA16G16
5-PRIME, mRNA sequence
Length = 475
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 471 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 412
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 411 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 352
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 351 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 292
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 291 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 232
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 231 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 172
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 171 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 115
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 114 ttcttctccgccgcgggcttcttctcggccttgggcgccat 74
>gb|BU979612.1|BU979612 HA16L11r HA Hordeum vulgare subsp. vulgare cDNA clone HA16L11
5-PRIME, mRNA sequence
Length = 542
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|BU979716.1|BU979716 HA17A16r HA Hordeum vulgare subsp. vulgare cDNA clone HA17A16
5-PRIME, mRNA sequence
Length = 434
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 429 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 370
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 369 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 310
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 309 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 250
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 249 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 190
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 189 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 130
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 129 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 73
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 72 ttcttctccgccgcgggcttcttctcggccttgggcgccat 32
>gb|BU980231.1|BU980231 HA20B03r HA Hordeum vulgare subsp. vulgare cDNA clone HA20B03
5-PRIME, mRNA sequence
Length = 547
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 532 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 473
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 472 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 413
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 412 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 353
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 352 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 293
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 292 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 233
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 232 ctgcccttcttctcgccgccctccttg 206
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 146 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 101
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 119 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 67
>gb|BU981929.1|BU981929 HA25A12r HA Hordeum vulgare subsp. vulgare cDNA clone HA25A12
5-PRIME, mRNA sequence
Length = 550
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 540 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 481
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 480 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 421
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 420 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 361
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 360 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 301
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 300 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 241
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 240 ctgcccttcttctcgccgccctccttg 214
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 154 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 109
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 127 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 75
>gb|BU983269.1|BU983269 HA29C08r HA Hordeum vulgare subsp. vulgare cDNA clone HA29C08
5-PRIME, mRNA sequence
Length = 462
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 458 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 399
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 398 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 339
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 338 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 279
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 278 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 219
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 218 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 159
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 158 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 102
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 101 ttcttctccgccgcgggcttcttctcggccttgggcgccat 61
>gb|CA012215.1|CA012215 HT04M17r HT Hordeum vulgare subsp. vulgare cDNA clone HT04M17
5-PRIME, mRNA sequence
Length = 468
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 462 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 403
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 402 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 343
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 342 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 283
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 282 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 223
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 222 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 163
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 162 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 106
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 105 ttcttctccgccgcgggcttcttctcggccttgggcgccat 65
>gb|CA018589.1|CA018589 HV09B05r HV Hordeum vulgare subsp. vulgare cDNA clone HV09B05
5-PRIME, mRNA sequence
Length = 602
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 468
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 467 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 408
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 407 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 348
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 347 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 288
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 287 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 228
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 227 ctgcccttcttctcgccgccctccttg 201
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 141 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 96
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 114 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 62
>gb|CA028621.1|CA028621 HZ62K14r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ62K14
5-PRIME, mRNA sequence
Length = 468
Score = 466 bits (235), Expect = e-130
Identities = 360/401 (89%), Gaps = 3/401 (0%)
Strand = Plus / Minus
Query: 330 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 389
|||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 460 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 401
Query: 390 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 449
|||||||| || | |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 400 acgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgc 341
Query: 450 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 509
||||||||||| | |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 340 gcgagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 281
Query: 510 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 569
||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||||||
Sbjct: 280 atggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttgaag 221
Query: 570 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 629
|||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||
Sbjct: 220 atgtagatcttgtacgtctccacgctcttcttggccttcttcttcttcttgtcggcgccg 161
Query: 630 ccctccttgcccggcacgcgcttctccgccctgggcttcttctcggccttctcctccgtc 689
|| |||||||| |||||||||||||| ||| ||||||||||||| || |||| | | |
Sbjct: 160 ccgtccttgccgggcacgcgcttctcggccttgggcttcttctccgc---ctccacaggc 104
Query: 690 ggcttcttctccgcgggcttcttctcggccttgggcgccat 730
||||| | |||||||||||||||||||||||||||||||
Sbjct: 103 ttcttctccgccgcgggcttcttctcggccttgggcgccat 63
>gb|CA031561.1|CA031561 HX10G09r HX Hordeum vulgare subsp. vulgare cDNA clone HX10G09
5-PRIME, mRNA sequence
Length = 516
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 497 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 438
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 437 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 378
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 377 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 318
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 317 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 258
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 257 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 198
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 197 ctgcccttcttctcgccgccctccttg 171
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 111 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 66
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 84 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 32
>gb|CA032140.1|CA032140 HX12C05r HX Hordeum vulgare subsp. vulgare cDNA clone HX12C05
5-PRIME, mRNA sequence
Length = 630
Score = 466 bits (235), Expect = e-130
Identities = 304/327 (92%)
Strand = Plus / Minus
Query: 312 gcgatctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttg 371
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 506 gcgatctaagaggaggtaaacttggtgacggccttggtgccctcggagacggcgtgcttg 447
Query: 372 gcgagctcgccaggaaggacgaggcgcaccgaagtctggatctcccgggaggttatggtg 431
|||||||| || || ||||||||||| || || |||||||||||||||||||| ||||||
Sbjct: 446 gcgagctccccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtg 387
Query: 432 ggcttcttgttgtagcgggcgagcttggcggcctcggcagccagcttctcgaagatgtcg 491
||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||
Sbjct: 386 ggcttcttgttgtagcgagcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 327
Query: 492 ttgatgaaggagttcatgatggacatggccttggacgagataccaatgtccgggtgcacc 551
||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 326 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 267
Query: 552 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttc 611
|||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 266 tgcttgagaaccttgaagatgtagatcttgtacgtctccacgctcttcttgcccttcttc 207
Query: 612 ttccccttcttctcgccgccctccttg 638
| ||||||||||||||||||||||||
Sbjct: 206 ctgcccttcttctcgccgccctccttg 180
Score = 60.0 bits (30), Expect = 1e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 668 cttctcggccttctcctccgtcggcttcttctccgcgggcttcttc 713
|||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 120 cttctcggccttctccgtcgtcggctcctcctccgcgggcttcttc 75
Score = 58.0 bits (29), Expect = 5e-007
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 680 ctcctccgtcggcttcttctccgcgggcttcttctcggccttgggcgccatcg 732
|||||||| ||||||||| |||| ||||||||||| |||||||| |||||||
Sbjct: 93 ctcctccgcgggcttcttcgccgccggcttcttctccgccttgggggccatcg 41
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 143,074
Number of Sequences: 312970
Number of extensions: 143074
Number of successful extensions: 50766
Number of sequences better than 0.5: 1539
Number of HSP's better than 0.5 without gapping: 1539
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41919
Number of HSP's gapped (non-prelim): 8272
length of query: 842
length of database: 175,134,539
effective HSP length: 19
effective length of query: 823
effective length of database: 169,188,109
effective search space: 139241813707
effective search space used: 139241813707
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)