BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.203
(959 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB858312.1|CB858312 HI06J01w HI Hordeum vulgare subsp. v... 224 4e-057
gb|BJ448342.1|BJ448342 BJ448342 K. Sato unpublished cDNA li... 216 1e-054
gb|BJ456060.1|BJ456060 BJ456060 K. Sato unpublished cDNA li... 216 1e-054
gb|CA024654.1|CA024654 HZ49O19r HZ Hordeum vulgare subsp. v... 216 1e-054
gb|CB858998.1|CB858998 HI08P12w HI Hordeum vulgare subsp. v... 208 2e-052
gb|CK123693.1|CK123693 BES1824105b19 BES1824 Hordeum vulgar... 188 2e-046
gb|CB859638.1|CB859638 HI11B10w HI Hordeum vulgare subsp. v... 178 2e-043
gb|BE420572.1|BE420572 HWM000.C09 ITEC HWM Barley Leaf Libr... 174 3e-042
gb|CB859980.1|CB859980 HI12D15w HI Hordeum vulgare subsp. v... 121 4e-026
gb|BF628643.2|BF628643 HVSMEb0006N23f Hordeum vulgare seedl... 96 3e-018
gb|CB858919.1|CB858919 HI08L14w HI Hordeum vulgare subsp. v... 92 4e-017
gb|CA027544.1|CA027544 HZ59E07r HZ Hordeum vulgare subsp. v... 90 2e-016
gb|BI950729.1|BI950729 HVSMEl0023A02f Hordeum vulgare spike... 66 2e-009
gb|BI777552.2|BI777552 EBro04_SQ001_J04_R root, 3 week, sal... 62 4e-008
gb|AV912950.1|AV912950 AV912950 K. Sato unpublished cDNA li... 48 5e-004
gb|AV917706.1|AV917706 AV917706 K. Sato unpublished cDNA li... 48 5e-004
gb|AJ434576.1|AJ434576 AJ434576 S00002 Hordeum vulgare subs... 48 5e-004
gb|AJ463257.1|AJ463257 AJ463257 S00002 Hordeum vulgare subs... 48 5e-004
gb|AJ463258.1|AJ463258 AJ463258 S00002 Hordeum vulgare subs... 48 5e-004
gb|BJ452042.1|BJ452042 BJ452042 K. Sato unpublished cDNA li... 48 5e-004
gb|BJ459599.1|BJ459599 BJ459599 K. Sato unpublished cDNA li... 48 5e-004
gb|CA008281.1|CA008281 HU10H13r HU Hordeum vulgare subsp. v... 48 5e-004
gb|BF622994.1|BF622994 HVSMEa0012I07f Hordeum vulgare seedl... 46 0.002
gb|AV911446.1|AV911446 AV911446 K. Sato unpublished cDNA li... 44 0.008
gb|BE421032.1|BE421032 HWM005.B01 ITEC HWM Barley Leaf Libr... 42 0.033
gb|BE421843.1|BE421843 HWM015cD.02r ITEC HWM Barley Leaf Li... 42 0.033
gb|BF265428.3|BF265428 HV_CEa0012D19f Hordeum vulgare seedl... 42 0.033
gb|CD662528.1|CD662528 UCRHV18_02ba05_b1 Drought-stressed D... 42 0.033
gb|AL505633.1|AL505633 AL505633 Hordeum vulgare Barke roots... 40 0.13
gb|BF255418.3|BF255418 HVSMEf0006M22f Hordeum vulgare seedl... 40 0.13
gb|BF267554.3|BF267554 HV_CEa0018E06f Hordeum vulgare seedl... 40 0.13
gb|BJ447398.1|BJ447398 BJ447398 K. Sato unpublished cDNA li... 40 0.13
gb|BJ447891.1|BJ447891 BJ447891 K. Sato unpublished cDNA li... 40 0.13
gb|BJ448110.1|BJ448110 BJ448110 K. Sato unpublished cDNA li... 40 0.13
gb|BJ448486.1|BJ448486 BJ448486 K. Sato unpublished cDNA li... 40 0.13
gb|BJ453038.1|BJ453038 BJ453038 K. Sato unpublished cDNA li... 40 0.13
gb|BJ455149.1|BJ455149 BJ455149 K. Sato unpublished cDNA li... 40 0.13
gb|BJ455637.1|BJ455637 BJ455637 K. Sato unpublished cDNA li... 40 0.13
gb|BJ455845.1|BJ455845 BJ455845 K. Sato unpublished cDNA li... 40 0.13
gb|BJ456207.1|BJ456207 BJ456207 K. Sato unpublished cDNA li... 40 0.13
gb|BJ460586.1|BJ460586 BJ460586 K. Sato unpublished cDNA li... 40 0.13
gb|BQ467975.1|BQ467975 HR01I11r HR Hordeum vulgare subsp. v... 40 0.13
gb|BM376778.2|BM376778 EBem05_SQ003_D10_R embryo, 14 DPA, n... 40 0.13
gb|CA016183.1|CA016183 HV09O15u HV Hordeum vulgare subsp. v... 40 0.13
gb|CA018876.1|CA018876 HV09O15r HV Hordeum vulgare subsp. v... 40 0.13
>gb|CB858312.1|CB858312 HI06J01w HI Hordeum vulgare subsp. vulgare cDNA clone HI06J01
3-PRIME, mRNA sequence
Length = 641
Score = 224 bits (113), Expect = 4e-057
Identities = 217/251 (86%), Gaps = 3/251 (1%)
Strand = Plus / Plus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 250 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 309
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 310 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 369
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 370 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 429
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggac 560
||||||| ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||||
Sbjct: 430 ccgagaaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggac 489
Query: 561 ggcgtgggcgt 571
|||||||||||
Sbjct: 490 ggcgtgggcgt 500
>gb|BJ448342.1|BJ448342 BJ448342 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak19j05 5', mRNA sequence
Length = 521
Score = 216 bits (109), Expect = 1e-054
Identities = 216/251 (86%), Gaps = 3/251 (1%)
Strand = Plus / Minus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 262 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 203
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 202 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 143
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 142 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 83
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggac 560
||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||||
Sbjct: 82 ccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggac 23
Query: 561 ggcgtgggcgt 571
|||||||||||
Sbjct: 22 ggcgtgggcgt 12
>gb|BJ456060.1|BJ456060 BJ456060 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak19j05 3', mRNA sequence
Length = 473
Score = 216 bits (109), Expect = 1e-054
Identities = 216/251 (86%), Gaps = 3/251 (1%)
Strand = Plus / Plus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 212 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 271
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 272 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 331
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 332 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 391
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggac 560
||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||||
Sbjct: 392 ccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggac 451
Query: 561 ggcgtgggcgt 571
|||||||||||
Sbjct: 452 ggcgtgggcgt 462
>gb|CA024654.1|CA024654 HZ49O19r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ49O19
5-PRIME, mRNA sequence
Length = 514
Score = 216 bits (109), Expect = 1e-054
Identities = 216/251 (86%), Gaps = 3/251 (1%)
Strand = Plus / Minus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 417 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 358
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 357 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 298
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 297 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 238
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggac 560
||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||||
Sbjct: 237 ccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggac 178
Query: 561 ggcgtgggcgt 571
|||||||||||
Sbjct: 177 ggcgtgggcgt 167
>gb|CB858998.1|CB858998 HI08P12w HI Hordeum vulgare subsp. vulgare cDNA clone HI08P12
3-PRIME, mRNA sequence
Length = 456
Score = 208 bits (105), Expect = 2e-052
Identities = 215/251 (85%), Gaps = 3/251 (1%)
Strand = Plus / Plus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 197 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 256
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||| ||||||| |||| |||||||
Sbjct: 257 gcgaggttgagcaccttggccttgatggcggtgcagaggtacgccgcggcggtgagcccg 316
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 317 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 376
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggac 560
||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||||
Sbjct: 377 ccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggac 436
Query: 561 ggcgtgggcgt 571
|||||||||||
Sbjct: 437 ggcgtgggcgt 447
>gb|CK123693.1|CK123693 BES1824105b19 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010B195 5-PRIME, mRNA sequence
Length = 535
Score = 188 bits (95), Expect = 2e-046
Identities = 216/253 (85%), Gaps = 5/253 (1%)
Strand = Plus / Minus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 415 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 356
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcac-gccgccgcggagagccc 439
| || || ||||||||||||||||||||||||||| |||||| ||||| |||| ||||||
Sbjct: 355 gcgaggttgagcaccttggccttgatggcggtgcagaggcaccgccgcggcggtgagccc 296
Query: 440 ggcgatgcccttcacgagcggg-cagcactggacgttggcgtcgccgacgtgcacctcgt 498
||||||||||| ||| || ||| ||||||| |||| |||||||||||| ||| | |||||
Sbjct: 295 ggcgatgccctgcaccaggggggcagcacttgacgctggcgtcgccgatgtggagctcgt 236
Query: 499 tcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgagg 558
| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||
Sbjct: 235 tgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggagg 176
Query: 559 acggcgtgggcgt 571
|||||||||||||
Sbjct: 175 acggcgtgggcgt 163
>gb|CB859638.1|CB859638 HI11B10w HI Hordeum vulgare subsp. vulgare cDNA clone HI11B10
3-PRIME, mRNA sequence
Length = 538
Score = 178 bits (90), Expect = 2e-043
Identities = 194/228 (85%), Gaps = 3/228 (1%)
Strand = Plus / Plus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||| | |
Sbjct: 308 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtaaagg 367
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 368 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 427
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 428 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 487
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcac 548
||||| | ||||| ||| |||| ||||| |||| |||||| ||||||
Sbjct: 488 ccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcac 535
>gb|BE420572.1|BE420572 HWM000.C09 ITEC HWM Barley Leaf Library Hordeum vulgare subsp.
vulgare cDNA clone HWM000.C09, mRNA sequence
Length = 1035
Score = 174 bits (88), Expect = 3e-042
Identities = 183/214 (85%), Gaps = 3/214 (1%)
Strand = Plus / Minus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 370 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 311
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 310 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 251
Query: 441 gcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttc 500
|||||||||| ||| || |||||||||| |||| |||||||||||| ||| | ||||||
Sbjct: 250 gcgatgccctgcaccagggggcagcacttgacgctggcgtcgccgatgtggagctcgttg 191
Query: 501 ccgagaacgtccacgcaggcgccgagcttgagcg 534
||||| | ||||| ||| |||| ||||| ||||
Sbjct: 190 ccgagcaggtccaggcacacgcccagcttcagcg 157
>gb|CB859980.1|CB859980 HI12D15w HI Hordeum vulgare subsp. vulgare cDNA clone HI12D15
3-PRIME, mRNA sequence
Length = 430
Score = 121 bits (61), Expect = 4e-026
Identities = 108/123 (87%), Gaps = 3/123 (2%)
Strand = Plus / Plus
Query: 324 ggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacg 380
||||| |||||||||||||||| ||||||||| || ||| |||| ||||||||||| |
Sbjct: 308 ggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgaggggcacgtagagg 367
Query: 381 gagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccg 440
| || || ||||||||||||||||||||||||||| ||||||||||| |||| |||||||
Sbjct: 368 gcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccg 427
Query: 441 gcg 443
|||
Sbjct: 428 gcg 430
>gb|BF628643.2|BF628643 HVSMEb0006N23f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0006N23f, mRNA sequence
Length = 739
Score = 95.6 bits (48), Expect = 3e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 363 gcgatgggcacgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| ||||||||||| | || || |||| |||||||| ||||| ||||||| ||||||
Sbjct: 198 gcgacgggcacgtagaggacgaggttgagcgccttggccgtgatgtcggtgcagaggcac 139
Query: 423 gccgccgcggagagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcg 482
||||| |||| ||||||||||||||||| ||| || || ||||||| |||| ||| ||||
Sbjct: 138 gccgcggcggtgagcccggcgatgccctgcaccaggggccagcacttgacgctggtgtcg 79
Query: 483 ccga 486
||||
Sbjct: 78 ccga 75
>gb|CB858919.1|CB858919 HI08L14w HI Hordeum vulgare subsp. vulgare cDNA clone HI08L14
3-PRIME, mRNA sequence
Length = 396
Score = 91.7 bits (46), Expect = 4e-017
Identities = 93/108 (86%), Gaps = 3/108 (2%)
Strand = Plus / Plus
Query: 311 gcatttgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgat 367
|||| |||| || ||||| |||||||||||||||| ||||||||| || ||| ||||
Sbjct: 285 gcatgtgtatcccggcggcacggcgcagccgcagtcgttgacgagcagctggagggcgag 344
Query: 368 gggcacgtagacggagatgtcgagcaccttggccttgatggcggtgca 415
||||||||||| || || || |||||||||||||||||||||||||||
Sbjct: 345 gggcacgtagagggcgaggttgagcaccttggccttgatggcggtgca 392
>gb|CA027544.1|CA027544 HZ59E07r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ59E07
5-PRIME, mRNA sequence
Length = 287
Score = 89.7 bits (45), Expect = 2e-016
Identities = 96/113 (84%)
Strand = Plus / Minus
Query: 459 gggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcag 518
|||||||||| |||| |||||||||||| ||| | |||||| ||||| | ||||| |||
Sbjct: 279 gggcagcacttgacgctggcgtcgccgatgtggagctcgttgccgagcaggtccaggcac 220
Query: 519 gcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcgt 571
|||| ||||| |||| |||||| |||||| |||| |||||||||||||||||
Sbjct: 219 acgcccagcttcagcgtgtcgatcgggcacgtgtcggaggacggcgtgggcgt 167
>gb|BI950729.1|BI950729 HVSMEl0023A02f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0023A02f, mRNA sequence
Length = 990
Score = 65.9 bits (33), Expect = 2e-009
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 459 gggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcag 518
|||||||||| |||| |||||||||||| ||| | ||||| ||||| | ||||| |||
Sbjct: 320 gggcagcacttgacgctggcgtcgccgatgtggagttcgttgccgagcaggtccaggcac 261
Query: 519 gcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcgt 571
|||| ||||| |||| |||||| | |||| |||| ||||||||||||||||
Sbjct: 260 acgcccagcttcagcgtgtcgatcgtgcacgtgtcgaaggacggcgtgggcgt 208
>gb|BI777552.2|BI777552 EBro04_SQ001_J04_R root, 3 week, salt-stressed, cv Optic, EBro04
Hordeum vulgare subsp. vulgare cDNA clone
EBro04_SQ001_J04 5', mRNA sequence
Length = 349
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggca 421
|||| ||||||| ||||||||||||||||||||||||||
Sbjct: 98 gatgccgagcacgttggccttgatggcggtgcaaaggca 60
>gb|AV912950.1|AV912950 AV912950 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags11b23 5', mRNA sequence
Length = 629
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 360 gatgccgaggacgttggccttgatggcggtgcagaggcac 321
>gb|AV917706.1|AV917706 AV917706 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags11b23 3', mRNA sequence
Length = 563
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 306 gatgccgaggacgttggccttgatggcggtgcagaggcac 345
>gb|AJ434576.1|AJ434576 AJ434576 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200077B04F1, mRNA sequence
Length = 486
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 133 gatgccgaggacgttggccttgatggcggtgcagaggcac 94
>gb|AJ463257.1|AJ463257 AJ463257 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200028D03F1, mRNA sequence
Length = 360
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 223 gatgccgagaacgttggccttgatggcggtgcagaggcac 184
>gb|AJ463258.1|AJ463258 AJ463258 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200028D03F2, mRNA sequence
Length = 420
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 223 gatgccgagaacgttggccttgatggcggtgcagaggcac 184
>gb|BJ452042.1|BJ452042 BJ452042 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak37i07 5', mRNA sequence
Length = 394
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 115 gatgccgaggacgttggccttgatggcggtgcagaggcac 76
>gb|BJ459599.1|BJ459599 BJ459599 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak37i07 3', mRNA sequence
Length = 432
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 326 gatgccgaggacgttggccttgatggcggtgcagaggcac 365
>gb|CA008281.1|CA008281 HU10H13r HU Hordeum vulgare subsp. vulgare cDNA clone HU10H13
5-PRIME, mRNA sequence
Length = 465
Score = 48.1 bits (24), Expect = 5e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggcac 422
|||| |||| || |||||||||||||||||||| ||||||
Sbjct: 456 gatgccgagaacgttggccttgatggcggtgcagaggcac 417
>gb|BF622994.1|BF622994 HVSMEa0012I07f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0012I07f, mRNA sequence
Length = 802
Score = 46.1 bits (23), Expect = 0.002
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 556 aggacggcgtgggcgtgggtgtcggcgtcgg 586
||||||||||||| ||||| |||||||||||
Sbjct: 628 aggacggcgtgggagtgggcgtcggcgtcgg 598
>gb|AV911446.1|AV911446 AV911446 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak13d12 3', mRNA sequence
Length = 389
Score = 44.1 bits (22), Expect = 0.008
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 383 gatgtcgagcaccttggccttgatggcggtgcaaaggc 420
|||| |||| || |||||||||||||||||||| ||||
Sbjct: 351 gatgccgaggacgttggccttgatggcggtgcagaggc 388
>gb|BE421032.1|BE421032 HWM005.B01 ITEC HWM Barley Leaf Library Hordeum vulgare subsp.
vulgare cDNA clone HWM005.B01, mRNA sequence
Length = 1148
Score = 42.1 bits (21), Expect = 0.033
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 389 gagcaccttggccttgatggcggtgcaaaggca 421
|||| ||||||||||||||| |||||| |||||
Sbjct: 318 gagcgccttggccttgatggtggtgcagaggca 286
>gb|BE421843.1|BE421843 HWM015cD.02r ITEC HWM Barley Leaf Library Hordeum vulgare subsp.
vulgare cDNA clone HWM015cD.02, mRNA sequence
Length = 830
Score = 42.1 bits (21), Expect = 0.033
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 389 gagcaccttggccttgatggcggtgcaaaggca 421
|||| ||||||||||||||| |||||| |||||
Sbjct: 235 gagcgccttggccttgatggtggtgcagaggca 203
>gb|BF265428.3|BF265428 HV_CEa0012D19f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0012D19f, mRNA sequence
Length = 827
Score = 42.1 bits (21), Expect = 0.033
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 389 gagcaccttggccttgatggcggtgcaaaggca 421
|||| ||||||||||||||| |||||| |||||
Sbjct: 450 gagcgccttggccttgatggtggtgcagaggca 418
>gb|CD662528.1|CD662528 UCRHV18_02ba05_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_02ba05, mRNA sequence
Length = 395
Score = 42.1 bits (21), Expect = 0.033
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 389 gagcaccttggccttgatggcggtgcaaaggca 421
|||| ||||||||||||||| |||||| |||||
Sbjct: 333 gagcgccttggccttgatggtggtgcagaggca 365
>gb|AL505633.1|AL505633 AL505633 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW09B01V 5', mRNA sequence
Length = 473
Score = 40.1 bits (20), Expect = 0.13
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 398 ggccttgatggcggtgcaaaggca 421
|||||||||||||||||| |||||
Sbjct: 378 ggccttgatggcggtgcagaggca 355
>gb|BF255418.3|BF255418 HVSMEf0006M22f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0006M22f, mRNA sequence
Length = 485
Score = 40.1 bits (20), Expect = 0.13
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 398 ggccttgatggcggtgcaaaggca 421
|||||||||||||||||| |||||
Sbjct: 54 ggccttgatggcggtgcagaggca 31
>gb|BF267554.3|BF267554 HV_CEa0018E06f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0018E06f, mRNA sequence
Length = 513
Score = 40.1 bits (20), Expect = 0.13
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 508 cgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttg 551
||||||||||||| || ||||| ||| |||| | ||||||||||
Sbjct: 323 cgtccacgcaggccccaagcttcagcacgtccacggggcacttg 280
>gb|BJ447398.1|BJ447398 BJ447398 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak35f14 5', mRNA sequence
Length = 540
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 169 ccttggccttgatggtggtgcagaggca 142
>gb|BJ447891.1|BJ447891 BJ447891 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak17k09 5', mRNA sequence
Length = 500
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 114 ccttggccttgatggtggtgcagaggca 87
>gb|BJ448110.1|BJ448110 BJ448110 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak18j05 5', mRNA sequence
Length = 441
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 66 ccttggccttgatggtggtgcagaggca 39
>gb|BJ448486.1|BJ448486 BJ448486 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak20c05 5', mRNA sequence
Length = 504
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 129 ccttggccttgatggtggtgcagaggca 102
>gb|BJ453038.1|BJ453038 BJ453038 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak41g13 5', mRNA sequence
Length = 504
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 118 ccttggccttgatggtggtgcagaggca 91
>gb|BJ455149.1|BJ455149 BJ455149 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak35f14 3', mRNA sequence
Length = 564
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 406 ccttggccttgatggtggtgcagaggca 433
>gb|BJ455637.1|BJ455637 BJ455637 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak17k09 3', mRNA sequence
Length = 477
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 365 ccttggccttgatggtggtgcagaggca 392
>gb|BJ455845.1|BJ455845 BJ455845 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak18j05 3', mRNA sequence
Length = 414
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 349 ccttggccttgatggtggtgcagaggca 376
>gb|BJ456207.1|BJ456207 BJ456207 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak20c05 3', mRNA sequence
Length = 488
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 362 ccttggccttgatggtggtgcagaggca 389
>gb|BJ460586.1|BJ460586 BJ460586 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak41g13 3', mRNA sequence
Length = 477
Score = 40.1 bits (20), Expect = 0.13
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 394 ccttggccttgatggcggtgcaaaggca 421
||||||||||||||| |||||| |||||
Sbjct: 365 ccttggccttgatggtggtgcagaggca 392
>gb|BQ467975.1|BQ467975 HR01I11r HR Hordeum vulgare subsp. vulgare cDNA clone HR01I11
5-PRIME, mRNA sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.13
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 396 ttggccttgatggcggtgcaaaggcacgccgc 427
|||||| ||||||||||||| |||||| ||||
Sbjct: 351 ttggccctgatggcggtgcagaggcacaccgc 320
>gb|BM376778.2|BM376778 EBem05_SQ003_D10_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ003_D10 5', mRNA sequence
Length = 482
Score = 40.1 bits (20), Expect = 0.13
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 398 ggccttgatggcggtgcaaaggca 421
|||||||||||||||||| |||||
Sbjct: 169 ggccttgatggcggtgcagaggca 146
>gb|CA016183.1|CA016183 HV09O15u HV Hordeum vulgare subsp. vulgare cDNA clone HV09O15
3-PRIME, mRNA sequence
Length = 529
Score = 40.1 bits (20), Expect = 0.13
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 396 ttggccttgatggcggtgcaaaggcacgccgc 427
|||||| ||||||||||||| |||||| ||||
Sbjct: 330 ttggccctgatggcggtgcagaggcacaccgc 361
>gb|CA018876.1|CA018876 HV09O15r HV Hordeum vulgare subsp. vulgare cDNA clone HV09O15
5-PRIME, mRNA sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.13
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 396 ttggccttgatggcggtgcaaaggcacgccgc 427
|||||| ||||||||||||| |||||| ||||
Sbjct: 351 ttggccctgatggcggtgcagaggcacaccgc 320
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 126,931
Number of Sequences: 312970
Number of extensions: 126931
Number of successful extensions: 35380
Number of sequences better than 0.5: 45
Number of HSP's better than 0.5 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35279
Number of HSP's gapped (non-prelim): 89
length of query: 959
length of database: 175,134,539
effective HSP length: 19
effective length of query: 940
effective length of database: 169,188,109
effective search space: 159036822460
effective search space used: 159036822460
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)