BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCN21b10.yg.2.1
(574 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815686.1|CN815686 HRO4514_D08_G16ZS5 Lib AA071E1X Aven... 40 0.002
gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, ... 38 0.008
gb|AY618689.1| Avena clauda strain CAV5566/1 cycloartenol s... 38 0.008
gb|AY618694.1| Avena ventricosa strain CAV2835 cycloartenol... 38 0.008
>gb|CN815686.1|CN815686 HRO4514_D08_G16ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4514_D08_G16, mRNA sequence
Length = 537
Score = 40.1 bits (20), Expect = 0.002
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 69 gtaatgttgaagaaagaagc 88
||||||||||||||||||||
Sbjct: 178 gtaatgttgaagaaagaagc 197
>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
Length = 571
Score = 38.2 bits (19), Expect = 0.008
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 5 gcggccgcccgggcaggta 23
>gb|AY618689.1| Avena clauda strain CAV5566/1 cycloartenol synthase gene, complete
cds
Length = 2280
Score = 38.2 bits (19), Expect = 0.008
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 95 ctttggagacattgtcatt 113
|||||||||||||||||||
Sbjct: 1650 ctttggagacattgtcatt 1668
>gb|AY618694.1| Avena ventricosa strain CAV2835 cycloartenol synthase gene, complete
cds
Length = 2280
Score = 38.2 bits (19), Expect = 0.008
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 95 ctttggagacattgtcatt 113
|||||||||||||||||||
Sbjct: 1650 ctttggagacattgtcatt 1668
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1310
Number of Sequences: 8143
Number of extensions: 1310
Number of successful extensions: 374
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 370
Number of HSP's gapped (non-prelim): 4
length of query: 574
length of database: 4,702,463
effective HSP length: 16
effective length of query: 558
effective length of database: 4,572,175
effective search space: 2551273650
effective search space used: 2551273650
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)