BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCH22b04.yg.2.1
(457 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820901.1|CN820901 HRO4421_C03_E05ZS5 Lib AA069E1X Aven... 36 0.026
gb|AF033096.1|AF033096 Avena sativa nonphototropic hypocoty... 36 0.026
gb|AF033097.1|AF033097 Avena sativa nonphototropic hypocoty... 36 0.026
>gb|CN820901.1|CN820901 HRO4421_C03_E05ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4421_C03_E05, mRNA
sequence
Length = 744
Score = 36.2 bits (18), Expect = 0.026
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 298 attatataccgtgatcttaaaccaga 323
||||||||||||||| | ||||||||
Sbjct: 426 attatataccgtgatttgaaaccaga 451
>gb|AF033096.1|AF033096 Avena sativa nonphototropic hypocotyl 1 (NPH1-1) mRNA, complete cds
Length = 3467
Score = 36.2 bits (18), Expect = 0.026
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 10 tactttgccatgaaggttatggataa 35
|||||||||||||| | |||||||||
Sbjct: 2258 tactttgccatgaaagctatggataa 2283
>gb|AF033097.1|AF033097 Avena sativa nonphototropic hypocotyl 1 (NPH1-2) mRNA, complete cds
Length = 3422
Score = 36.2 bits (18), Expect = 0.026
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 10 tactttgccatgaaggttatggataa 35
|||||||||||||| | |||||||||
Sbjct: 2195 tactttgccatgaaagctatggataa 2220
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1005
Number of Sequences: 8143
Number of extensions: 1005
Number of successful extensions: 262
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 259
Number of HSP's gapped (non-prelim): 3
length of query: 457
length of database: 4,702,463
effective HSP length: 16
effective length of query: 441
effective length of database: 4,572,175
effective search space: 2016329175
effective search space used: 2016329175
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)