BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBJ23f06.xg.2.1
(683 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820072.1|CN820072 HRO4410_G07_M14ZS5 Lib AA069E1X Aven... 131 9e-031
gb|CN818277.1|CN818277 HRO4470_C12_F24ZS5 Lib AA070E1X Aven... 52 7e-007
>gb|CN820072.1|CN820072 HRO4410_G07_M14ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4410_G07_M14, mRNA
sequence
Length = 798
Score = 131 bits (66), Expect = 9e-031
Identities = 133/156 (85%)
Strand = Plus / Plus
Query: 427 tttggtacttatcttgagcatgacattggtcaccacacatctggcgatcaccagnagctt 486
||||||||||||||||||||||||||| || | || ||| |||||||| ||| || |
Sbjct: 32 tttggtacttatcttgagcatgacattagttatcaaacaagcggcgatcatcagaagatc 91
Query: 487 ttacttgcctatgtggggattccacgctacgaaggtcctgaggttgatcctaccattgng 546
||||| |||||| | || ||||||||||| ||||| |||||||||||||| || || | |
Sbjct: 92 ttactagcctatctcggcattccacgctatgaagggcctgaggttgatcccactatagtg 151
Query: 547 acacatgatgcaaaggatttgtacaaagctggtgag 582
||||||||||||||||| |||||||||||||||||
Sbjct: 152 acacatgatgcaaaggacctgtacaaagctggtgag 187
Score = 42.1 bits (21), Expect = 6e-004
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 622 ttcactgnacgcngctgggcacacntggca 651
||||||| |||| ||||||||||| |||||
Sbjct: 227 ttcactgaacgcagctgggcacacatggca 256
>gb|CN818277.1|CN818277 HRO4470_C12_F24ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4470_C12_F24, mRNA sequence
Length = 620
Score = 52.0 bits (26), Expect = 7e-007
Identities = 50/57 (87%), Gaps = 1/57 (1%)
Strand = Plus / Plus
Query: 527 aggttgatcctaccattgngacacatg-atgcaaaggatttgtacaaagctggtgag 582
|||||||||| || || | |||||||| |||||||||| |||||||||||||||||
Sbjct: 25 aggttgatcccactatagtgacacatgtatgcaaaggacctgtacaaagctggtgag 81
Score = 42.1 bits (21), Expect = 6e-004
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 622 ttcactgnacgcngctgggcacacntggca 651
||||||| |||| ||||||||||| |||||
Sbjct: 121 ttcactgaacgcagctgggcacacatggca 150
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1343
Number of Sequences: 8143
Number of extensions: 1343
Number of successful extensions: 332
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 327
Number of HSP's gapped (non-prelim): 4
length of query: 683
length of database: 4,702,463
effective HSP length: 16
effective length of query: 667
effective length of database: 4,572,175
effective search space: 3049640725
effective search space used: 3049640725
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)