BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE23e10.yg.3.1
(2083 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN816099.1|CN816099 HRO4517_A03_A05ZS5 Lib AA071E1X Aven... 525 e-149
gb|CN815134.1|CN815134 HRO4506_C04_E08ZS5 Lib AA071E1X Aven... 442 e-124
gb|CN815453.1|CN815453 HRO4509_H01_O01ZS5 Lib AA071E1X Aven... 34 0.48
gb|CN819592.1|CN819592 HRO4401_H10_O19ZS5 Lib AA069E1X Aven... 34 0.48
gb|AY618695.1| Avena clauda strain CAV5566/1 beta-amyrin sy... 34 0.48
gb|AY618700.1| Avena ventricosa strain CAV2835 beta-amyrin ... 34 0.48
>gb|CN816099.1|CN816099 HRO4517_A03_A05ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4517_A03_A05, mRNA sequence
Length = 720
Score = 525 bits (265), Expect = e-149
Identities = 596/705 (84%), Gaps = 1/705 (0%)
Strand = Plus / Plus
Query: 1165 atggagcgaggtggtctcaccgagaaggttgttagggacagagttctagtgttcaggttt 1224
||||||||||||||||| | ||||||||||| | |||| |||| |||||| | |||
Sbjct: 14 atggagcgaggtggtcttgctgagaaggttgtcaatgacaagattctggtgttccgcttt 73
Query: 1225 acagatgttggcaaacttcctccacctgtgctgcagtttgttgaagtcaagtttgggtat 1284
||||||||||||||||| || ||||| ||||| || |||| ||| |||| |||||| ||
Sbjct: 74 acagatgttggcaaactcccaccaccagtgctacaatttgctgatgtcacgtttggatac 133
Query: 1285 acaccagataatctcatatacaagagtcttgactttggagttgatcttgactctagaatc 1344
|| || ||||||||||| ||||||| ||||||||||| ||||| |||||||| ||| |
Sbjct: 134 actccggataatctcatttacaagaaccttgactttggtgttgaccttgactcaagagtt 193
Query: 1345 gcattggttggtcccaatggtgcagggaagagcactcttctgaagcttatgactggtgac 1404
||| ||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 194 gcactggttggtcccaatggtgcagggaaaagcacactcctgaagctcatgactggtgac 253
Query: 1405 cttgctccattagatggcatggttcggcgccacaatcacctgcgcattgcacagtaccat 1464
||| ||||||| ||||||||||| |||||||||||||||| |||||||| || | |||
Sbjct: 254 cttactccattggatggcatggtcaggcgccacaatcacctacgcattgctcaatttcat 313
Query: 1465 cagcatcttgcggacaagctggatctggacatgccggctctggcttacatgatgaaggaa 1524
|| ||||| | || |||||||||||||| ||||| |||||| |||||||||| |||
Sbjct: 314 caacatctcactgagaagctggatctggatatgccagctctgcagtacatgatgagggag 373
Query: 1525 taccctgggaccgaagaagagaagatgcgagctgctgttggcaggtttggcctatcagga 1584
|||||||||| || || ||||||||| ||||| | |||||| ||||||||| |||||
Sbjct: 374 taccctgggaatgaggaggagaagatgagagcttcaattggcaagtttggcctctcaggg 433
Query: 1585 aaggcgcaggtgatgccaatgaggaatctttctgatgggcaaaggagccgtgtcatcttt 1644
||||| ||||| |||||||||| ||||| || ||||| || | | |||||| ||||||
Sbjct: 434 aaggcacaggtaatgccaatgaaaaatctgtcagatggacagaaggcccgtgttatcttt 493
Query: 1645 gcatggttggcatataggcagccgcaactgctactgctcgatgagccgacaaatcatttg 1704
|| ||| |||||| ||||||||||| |||| |||| |||||||| ||||||||| |
Sbjct: 494 gcttggctggcattcaggcagccgcagatgcttttgcttgatgagcccacaaatcatctt 553
Query: 1705 gacattgagaccattgactccctggcggaggcactgaatgagtgggatggtggtttggtc 1764
||||||||||| ||||||||||| |||||||||||||| || |||||||| || || |||
Sbjct: 554 gacattgagacaattgactcccttgcggaggcactgaaggaatgggatgggggattagtc 613
Query: 1765 ttggtgagccatgatttcaggctgatcaaccaggttgctcaagagatttgggtgtgtgag 1824
| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 614 ctcgtgagccatgacttcaggctgatcaaccaggttgctcaagagatctgggtgtgtgag 673
Query: 1825 aatcaggcggtgacaaggtgggaaggtgatatcatggatttcaag 1869
|| |||||||| || ||||||| ||||||||| ||||||||||||
Sbjct: 674 aa-caggcggtaactaggtggggaggtgatattatggatttcaag 717
Score = 50.1 bits (25), Expect = 8e-006
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 817 cttttgcttgatgagcccacaaaccatct 845
||||||||||||||||||||||| |||||
Sbjct: 524 cttttgcttgatgagcccacaaatcatct 552
>gb|CN815134.1|CN815134 HRO4506_C04_E08ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4506_C04_E08, mRNA sequence
Length = 646
Score = 442 bits (223), Expect = e-124
Identities = 532/635 (83%)
Strand = Plus / Plus
Query: 1170 gcgaggtggtctcaccgagaaggttgttagggacagagttctagtgttcaggtttacaga 1229
|||||||||||| | ||||||||||| | |||| |||| |||||| | ||||||||
Sbjct: 12 gcgaggtggtcttgctgagaaggttgtcaatgacaagattctggtgttccgctttacaga 71
Query: 1230 tgttggcaaacttcctccacctgtgctgcagtttgttgaagtcaagtttgggtatacacc 1289
|||||||||||| || ||||| ||||| || |||| ||| |||| |||||| || || ||
Sbjct: 72 tgttggcaaactcccaccaccagtgctacaatttgctgatgtcacgtttggatacactcc 131
Query: 1290 agataatctcatatacaagagtcttgactttggagttgatcttgactctagaatcgcatt 1349
||||||||||| ||||||| ||||||||||| ||||| |||||||| ||| | ||| |
Sbjct: 132 ggataatctcatttacaagaaccttgactttggtgttgaccttgactcaagagttgcact 191
Query: 1350 ggttggtcccaatggtgcagggaagagcactcttctgaagcttatgactggtgaccttgc 1409
|||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| |
Sbjct: 192 ggttggtcccaatggtgcagggaaaagcacactcctgaagctcatgactggtgaccttac 251
Query: 1410 tccattagatggcatggttcggcgccacaatcacctgcgcattgcacagtaccatcagca 1469
|||||| ||||||||||| |||||||||||||||| |||||||| || | ||||| ||
Sbjct: 252 tccattggatggcatggtcaggcgccacaatcacctacgcattgctcaatttcatcaaca 311
Query: 1470 tcttgcggacaagctggatctggacatgccggctctggcttacatgatgaaggaataccc 1529
||| | || |||||||||||||| ||||| |||||| |||||||||| ||| |||||
Sbjct: 312 tctcactgagaagctggatctggatatgccagctctgcagtacatgatgagggagtaccc 371
Query: 1530 tgggaccgaagaagagaagatgcgagctgctgttggcaggtttggcctatcaggaaaggc 1589
||||| || || ||||||||| ||||| | |||||| ||||||||| ||||| |||||
Sbjct: 372 tgggaatgaggaggagaagatgagagcttcaattggcaagtttggcctctcagggaaggc 431
Query: 1590 gcaggtgatgccaatgaggaatctttctgatgggcaaaggagccgtgtcatctttgcatg 1649
||||| |||||||||| ||||| || ||||| || | | |||||| |||||||| ||
Sbjct: 432 acaggtaatgccaatgaaaaatctgtcagatggacagaaggcccgtgttatctttgcttg 491
Query: 1650 gttggcatataggcagccgcaactgctactgctcgatgagccgacaaatcatttggacat 1709
| |||||| ||||||||||| |||| |||| |||||||| ||||||||| | |||||
Sbjct: 492 gctggcattcaggcagccgcagatgcttttgcttgatgagcccacaaatcatcttgacat 551
Query: 1710 tgagaccattgactccctggcggaggcactgaatgagtgggatggtggtttggtcttggt 1769
|||||| ||||||||||| |||||||||||||| || |||||||| || || ||| | ||
Sbjct: 552 tgagacaattgactcccttgcggaggcactgaaggaatgggatgggggattagtcctcgt 611
Query: 1770 gagccatgatttcaggctgatcaaccaggttgctc 1804
||||||||| |||||||||||||||||||||||||
Sbjct: 612 gagccatgacttcaggctgatcaaccaggttgctc 646
Score = 50.1 bits (25), Expect = 8e-006
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 817 cttttgcttgatgagcccacaaaccatct 845
||||||||||||||||||||||| |||||
Sbjct: 517 cttttgcttgatgagcccacaaatcatct 545
>gb|CN815453.1|CN815453 HRO4509_H01_O01ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4509_H01_O01, mRNA sequence
Length = 671
Score = 34.2 bits (17), Expect = 0.48
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 714 gggttttgacaaacaaa 730
|||||||||||||||||
Sbjct: 91 gggttttgacaaacaaa 107
>gb|CN819592.1|CN819592 HRO4401_H10_O19ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4401_H10_O19, mRNA
sequence
Length = 827
Score = 34.2 bits (17), Expect = 0.48
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 714 gggttttgacaaacaaa 730
|||||||||||||||||
Sbjct: 826 gggttttgacaaacaaa 810
>gb|AY618695.1| Avena clauda strain CAV5566/1 beta-amyrin synthase gene, complete cds
Length = 2274
Score = 34.2 bits (17), Expect = 0.48
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 955 atccatatgcaaaacaa 971
|||||||||||||||||
Sbjct: 1855 atccatatgcaaaacaa 1839
>gb|AY618700.1| Avena ventricosa strain CAV2835 beta-amyrin synthase gene, complete
cds
Length = 2274
Score = 34.2 bits (17), Expect = 0.48
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 955 atccatatgcaaaacaa 971
|||||||||||||||||
Sbjct: 1855 atccatatgcaaaacaa 1839
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5891
Number of Sequences: 8143
Number of extensions: 5891
Number of successful extensions: 1622
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1610
Number of HSP's gapped (non-prelim): 9
length of query: 2083
length of database: 4,702,463
effective HSP length: 17
effective length of query: 2066
effective length of database: 4,564,032
effective search space: 9429290112
effective search space used: 9429290112
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)