BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE12f02.yg.2.1
(290 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815813.1|CN815813 HRO4510_G06_M12ZS5 Lib AA071E1X Aven... 48 4e-006
gb|CN819594.1|CN819594 HRO4401_H12_O23ZS5 Lib AA069E1X Aven... 44 7e-005
gb|CN819884.1|CN819884 HRO4407_C09_F17ZS5 Lib AA069E1X Aven... 44 7e-005
>gb|CN815813.1|CN815813 HRO4510_G06_M12ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4510_G06_M12, mRNA sequence
Length = 521
Score = 48.1 bits (24), Expect = 4e-006
Identities = 56/69 (81%)
Strand = Plus / Plus
Query: 72 gctggtgtttccaatgcaatcaataatggatacgagtcatggggnnnnnnnttcgggaag 131
|||||||||||| | ||| |||| ||||| |||| ||||||||| |||||||||
Sbjct: 74 gctggtgtttccgacgcagtcaacaatggctacgggtcatggggccccctcttcgggaag 133
Query: 132 ctcttcttt 140
|||||||||
Sbjct: 134 ctcttcttt 142
>gb|CN819594.1|CN819594 HRO4401_H12_O23ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4401_H12_O23, mRNA
sequence
Length = 620
Score = 44.1 bits (22), Expect = 7e-005
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 123 ttcgggaagctcttctttgcattttgggtgattg 156
||||| |||||||||||||| || ||||||||||
Sbjct: 29 ttcggaaagctcttctttgccttctgggtgattg 62
>gb|CN819884.1|CN819884 HRO4407_C09_F17ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4407_C09_F17, mRNA
sequence
Length = 676
Score = 44.1 bits (22), Expect = 7e-005
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 123 ttcgggaagctcttctttgcattttgggtgattg 156
||||| |||||||||||||| || ||||||||||
Sbjct: 118 ttcggaaagctcttctttgccttctgggtgattg 151
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 573
Number of Sequences: 8143
Number of extensions: 573
Number of successful extensions: 119
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114
Number of HSP's gapped (non-prelim): 4
length of query: 290
length of database: 4,702,463
effective HSP length: 15
effective length of query: 275
effective length of database: 4,580,318
effective search space: 1259587450
effective search space used: 1259587450
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)