BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAC22h02.sg.3.6
(2204 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN819783.1|CN819783 HRO4404_A07_B14ZS5 Lib AA069E1X Aven... 492 e-139
>gb|CN819783.1|CN819783 HRO4404_A07_B14ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4404_A07_B14, mRNA
sequence
Length = 662
Score = 492 bits (248), Expect = e-139
Identities = 392/440 (89%)
Strand = Plus / Plus
Query: 1405 aatgggctgcttggaaatatcgatgcaaacactggtgatcctcaagttggttgggacaca 1464
||||| ||||||||||| || || ||||||||||||||||| ||||||||||||||||||
Sbjct: 15 aatggtctgcttggaaacattgacgcaaacactggtgatccacaagttggttgggacaca 74
Query: 1465 gatcagttcatgacagacattgcagaggctactttggttatgtcaagtgtagttaagaat 1524
||| ||||| | ||||| ||| |||||||||||||||||||||||||||| |||||||||
Sbjct: 75 gatgagttcctcacagatatttcagaggctactttggttatgtcaagtgtggttaagaat 134
Query: 1525 ggtggacttgcacctggtggtttcaactttgatgccaaattgcggagggaaagtactgat 1584
||||| ||||| |||||||| |||||||| || || |||||||||||||| || ||||||
Sbjct: 135 ggtgggcttgcgcctggtggcttcaacttcgacgcgaaattgcggagggagagcactgat 194
Query: 1585 gttgaggacatgtttcttgcccatatctccggaatggacaccctggcacgtggcctccgt 1644
||||| ||||||||| |||| |||||||| || ||||||||| |||| ||||||||||
Sbjct: 195 gttgaagacatgtttattgctcatatctcagggatggacaccatggctcgtggcctccac 254
Query: 1645 aacgttgccaagctgattgaggatggttccctagatgatcttgtccgcaagcggtaccag 1704
|| ||||||||||| ||||||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 255 aatgttgccaagctaattgaggatggttcccttgatgagcttgtccgcaagcgctaccag 314
Query: 1705 agctttgatagtgagattggtgccttgatcgaggctgggaaaggagactttgagacgcta 1764
||||||||||||||||| |||||| |||| |||||||||||||||||||||||||| |||
Sbjct: 315 agctttgatagtgagatcggtgccatgattgaggctgggaaaggagactttgagacacta 374
Query: 1765 gaaaagaaggttctagagtggggtgagcccactgttgcatccggcaaacaggaactggcg 1824
||||||||||| | ||||||||||| || | |||| |||| |||||||||||||||||
Sbjct: 375 gaaaagaaggtcttggagtggggtgaaccaattgttccatctggcaaacaggaactggct 434
Query: 1825 gagattctgttccagtctgc 1844
||||| |||||||| |||||
Sbjct: 435 gagatgctgttccaatctgc 454
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5151
Number of Sequences: 8143
Number of extensions: 5151
Number of successful extensions: 1296
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1294
Number of HSP's gapped (non-prelim): 2
length of query: 2204
length of database: 4,702,463
effective HSP length: 17
effective length of query: 2187
effective length of database: 4,564,032
effective search space: 9981537984
effective search space used: 9981537984
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)