BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4534747.2.1
(628 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN819412.1|CN819412 HRO4405_G02_M03ZS5 Lib AA069E1X Aven... 40 0.002
>gb|CN819412.1|CN819412 HRO4405_G02_M03ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4405_G02_M03, mRNA
sequence
Length = 544
Score = 40.1 bits (20), Expect = 0.002
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 374 aagcagcacccgttctttgatggggtcaactgggca 409
||||||||||| |||||||| || || |||||||||
Sbjct: 99 aagcagcaccccttctttgaaggtgttaactgggca 134
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1298
Number of Sequences: 8143
Number of extensions: 1298
Number of successful extensions: 394
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 393
Number of HSP's gapped (non-prelim): 1
length of query: 628
length of database: 4,702,463
effective HSP length: 16
effective length of query: 612
effective length of database: 4,572,175
effective search space: 2798171100
effective search space used: 2798171100
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)