BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3748501.2.2
(993 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN814680.1|CN814680 HRO4501_D01_G01ZS5 Lib AA071E1X Aven... 48 2e-005
gb|CN820687.1|CN820687 HRO4416_D03_H06ZS5 Lib AA069E1X Aven... 48 2e-005
>gb|CN814680.1|CN814680 HRO4501_D01_G01ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4501_D01_G01, mRNA sequence
Length = 565
Score = 48.1 bits (24), Expect = 2e-005
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 443 taccacaagagctgcttcaagtgc 466
||||||||||||||||||||||||
Sbjct: 210 taccacaagagctgcttcaagtgc 233
Score = 34.2 bits (17), Expect = 0.23
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 167 tgcttcaagtgcagcca 183
|||||||||||||||||
Sbjct: 222 tgcttcaagtgcagcca 238
>gb|CN820687.1|CN820687 HRO4416_D03_H06ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4416_D03_H06, mRNA
sequence
Length = 516
Score = 48.1 bits (24), Expect = 2e-005
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 443 taccacaagagctgcttcaagtgc 466
||||||||||||||||||||||||
Sbjct: 107 taccacaagagctgcttcaagtgc 130
Score = 34.2 bits (17), Expect = 0.23
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 167 tgcttcaagtgcagcca 183
|||||||||||||||||
Sbjct: 119 tgcttcaagtgcagcca 135
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2274
Number of Sequences: 8143
Number of extensions: 2274
Number of successful extensions: 634
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 630
Number of HSP's gapped (non-prelim): 4
length of query: 993
length of database: 4,702,463
effective HSP length: 16
effective length of query: 977
effective length of database: 4,572,175
effective search space: 4467014975
effective search space used: 4467014975
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)