BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3191506.2.1
         (1208 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN821264.1|CN821264  HRO4423_D02_H03ZS5 Lib AA069E1X Aven...    62   1e-009
gb|AF118559.1|AF118559  Avena fatua puroindoline precursor, ...    38   0.018
gb|CN817517.1|CN817517  HRO4466_E06_J12ZS5 Lib AA070E1X Aven...    36   0.070
gb|CN816373.1|CN816373  HRO4520_A03_B06ZS5 Lib AA071E1X Aven...    34   0.28 

>gb|CN821264.1|CN821264 HRO4423_D02_H03ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
            leaf Avena sativa cDNA clone HRO4423_D02_H03, mRNA
            sequence
          Length = 733

 Score = 61.9 bits (31), Expect = 1e-009
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1038 cttttcctggatgatgatatagttgtccagagggacctaactggactctgggaggttgat 1097
            |||||||| |||||||| |||||||| ||||  ||  | || ||| | ||||| ||||||
Sbjct: 28   cttttcctcgatgatgacatagttgtgcagaaagatttgacaggattatgggatgttgat 87

                                                                       
Query: 1098 cttaatggaaatgtaaatggagccgtggaaacatgtggagagagttttcaccgatttga 1156
            || || ||||| || ||||| || ||||| || |||||||||||||| ||||| |||||
Sbjct: 88   ctaaaaggaaaggtcaatggtgcagtggagacctgtggagagagtttccaccgttttga 146



>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
          Length = 571

 Score = 38.2 bits (19), Expect = 0.018
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1190 tacctgcccgggcggccgc 1208
            |||||||||||||||||||
Sbjct: 23   tacctgcccgggcggccgc 5



>gb|CN817517.1|CN817517 HRO4466_E06_J12ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
           Avena sativa cDNA clone HRO4466_E06_J12, mRNA sequence
          Length = 481

 Score = 36.2 bits (18), Expect = 0.070
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 358 cttcggatagaaccaaagcaat 379
           |||| |||||||||||||||||
Sbjct: 93  cttcagatagaaccaaagcaat 72



>gb|CN816373.1|CN816373 HRO4520_A03_B06ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4520_A03_B06, mRNA sequence
          Length = 483

 Score = 34.2 bits (17), Expect = 0.28
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 324 gaagctactgctgatgc 340
           |||||||||||||||||
Sbjct: 28  gaagctactgctgatgc 12



  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3397
Number of Sequences: 8143
Number of extensions: 3397
Number of successful extensions: 886
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 882
Number of HSP's gapped (non-prelim): 4
length of query: 1208
length of database: 4,702,463
effective HSP length: 16
effective length of query: 1192
effective length of database: 4,572,175
effective search space: 5450032600
effective search space used: 5450032600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)