BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3092809.2.1
         (652 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN815817.1|CN815817  HRO4510_G10_M20ZS5 Lib AA071E1X Aven...    34   0.15 
gb|CN818135.1|CN818135  HRO4471_E10_I19ZS5 Lib AA070E1X Aven...    34   0.15 
gb|CN821602.1|CN821602  HRO4408_B08_D16ZS5 Lib AA069E1X Aven...    34   0.15 
>gb|CN815817.1|CN815817 HRO4510_G10_M20ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4510_G10_M20, mRNA sequence
          Length = 563

 Score = 34.2 bits (17), Expect = 0.15
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 115 gctcggccgccacgggg 131
           |||||||||||||||||
Sbjct: 123 gctcggccgccacgggg 139
>gb|CN818135.1|CN818135 HRO4471_E10_I19ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
           Avena sativa cDNA clone HRO4471_E10_I19, mRNA sequence
          Length = 498

 Score = 34.2 bits (17), Expect = 0.15
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 237 ttgtcggcggcgaggcc 253
           |||||||||||||||||
Sbjct: 128 ttgtcggcggcgaggcc 144
>gb|CN821602.1|CN821602 HRO4408_B08_D16ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
           leaf Avena sativa cDNA clone HRO4408_B08_D16, mRNA
           sequence
          Length = 710

 Score = 34.2 bits (17), Expect = 0.15
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 406 gttgaggcatttatgccagct 426
           ||||||| |||||||||||||
Sbjct: 176 gttgaggtatttatgccagct 196
  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1299
Number of Sequences: 8143
Number of extensions: 1299
Number of successful extensions: 409
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 406
Number of HSP's gapped (non-prelim): 3
length of query: 652
length of database: 4,702,463
effective HSP length: 16
effective length of query: 636
effective length of database: 4,572,175
effective search space: 2907903300
effective search space used: 2907903300
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)