BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3092809.2.1
(652 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815817.1|CN815817 HRO4510_G10_M20ZS5 Lib AA071E1X Aven... 34 0.15
gb|CN818135.1|CN818135 HRO4471_E10_I19ZS5 Lib AA070E1X Aven... 34 0.15
gb|CN821602.1|CN821602 HRO4408_B08_D16ZS5 Lib AA069E1X Aven... 34 0.15
>gb|CN815817.1|CN815817 HRO4510_G10_M20ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4510_G10_M20, mRNA sequence
Length = 563
Score = 34.2 bits (17), Expect = 0.15
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 115 gctcggccgccacgggg 131
|||||||||||||||||
Sbjct: 123 gctcggccgccacgggg 139
>gb|CN818135.1|CN818135 HRO4471_E10_I19ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4471_E10_I19, mRNA sequence
Length = 498
Score = 34.2 bits (17), Expect = 0.15
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 237 ttgtcggcggcgaggcc 253
|||||||||||||||||
Sbjct: 128 ttgtcggcggcgaggcc 144
>gb|CN821602.1|CN821602 HRO4408_B08_D16ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4408_B08_D16, mRNA
sequence
Length = 710
Score = 34.2 bits (17), Expect = 0.15
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 406 gttgaggcatttatgccagct 426
||||||| |||||||||||||
Sbjct: 176 gttgaggtatttatgccagct 196
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1299
Number of Sequences: 8143
Number of extensions: 1299
Number of successful extensions: 409
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 406
Number of HSP's gapped (non-prelim): 3
length of query: 652
length of database: 4,702,463
effective HSP length: 16
effective length of query: 636
effective length of database: 4,572,175
effective search space: 2907903300
effective search space used: 2907903300
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)