BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943885.2.1
(581 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820825.1|CN820825 HRO4420_C10_F20ZS5 Lib AA069E1X Aven... 38 0.008
gb|AA231640.1|AA231640 CDO204.F cDNA from oat Avena sativa ... 36 0.033
gb|BE439041.1|BE439041 CDO204_WHE2D0011F ITEC CDO Oat cDNA ... 36 0.033
gb|BE439081.1|BE439081 CDO204_WHE2D0012F ITEC CDO Oat cDNA ... 36 0.033
gb|BE439094.1|BE439094 CDO204_WHE2H0032F ITEC CDO Oat cDNA ... 36 0.033
gb|CN821651.1|CN821651 HRO4408_F11_L22Z Lib AA069E1X Avena ... 34 0.13
>gb|CN820825.1|CN820825 HRO4420_C10_F20ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4420_C10_F20, mRNA
sequence
Length = 621
Score = 38.2 bits (19), Expect = 0.008
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 188 acgcactgcgggtggaactcgac 210
||||||||||| |||||||||||
Sbjct: 117 acgcactgcggttggaactcgac 139
>gb|AA231640.1|AA231640 CDO204.F cDNA from oat Avena sativa cDNA clone CDO204, mRNA
sequence
Length = 376
Score = 36.2 bits (18), Expect = 0.033
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 462 acaagaacattgcagaat 479
||||||||||||||||||
Sbjct: 45 acaagaacattgcagaat 62
>gb|BE439041.1|BE439041 CDO204_WHE2D0011F ITEC CDO Oat cDNA Library Avena sativa cDNA clone
CDO204_WHE2D0011, mRNA sequence
Length = 373
Score = 36.2 bits (18), Expect = 0.033
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 462 acaagaacattgcagaat 479
||||||||||||||||||
Sbjct: 42 acaagaacattgcagaat 59
>gb|BE439081.1|BE439081 CDO204_WHE2D0012F ITEC CDO Oat cDNA Library Avena sativa cDNA clone
CDO204_WHE2D0012, mRNA sequence
Length = 414
Score = 36.2 bits (18), Expect = 0.033
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 462 acaagaacattgcagaat 479
||||||||||||||||||
Sbjct: 18 acaagaacattgcagaat 35
>gb|BE439094.1|BE439094 CDO204_WHE2H0032F ITEC CDO Oat cDNA Library Avena sativa cDNA clone
CDO204_WHE2H0032, mRNA sequence
Length = 312
Score = 36.2 bits (18), Expect = 0.033
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 462 acaagaacattgcagaat 479
||||||||||||||||||
Sbjct: 18 acaagaacattgcagaat 35
>gb|CN821651.1|CN821651 HRO4408_F11_L22Z Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4408_F11_L22, mRNA
sequence
Length = 453
Score = 34.2 bits (17), Expect = 0.13
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 393 tgtacgggaggaatgcc 409
|||||||||||||||||
Sbjct: 108 tgtacgggaggaatgcc 92
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1810
Number of Sequences: 8143
Number of extensions: 1810
Number of successful extensions: 926
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 920
Number of HSP's gapped (non-prelim): 6
length of query: 581
length of database: 4,702,463
effective HSP length: 16
effective length of query: 565
effective length of database: 4,572,175
effective search space: 2583278875
effective search space used: 2583278875
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)