BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2441599.2.2
(767 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN816296.1|CN816296 HRO4519_B07_D13ZS5 Lib AA071E1X Aven... 98 1e-020
gb|CN815413.1|CN815413 HRO4509_D05_G09ZS5 Lib AA071E1X Aven... 66 5e-011
gb|CN815533.1|CN815533 HRO4512_F11_L22ZS5 Lib AA071E1X Aven... 34 0.17
gb|AF140554.1|AF140554 Avena sativa DNA-binding protein WRK... 34 0.17
>gb|CN816296.1|CN816296 HRO4519_B07_D13ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4519_B07_D13, mRNA sequence
Length = 399
Score = 97.6 bits (49), Expect = 1e-020
Identities = 88/101 (87%)
Strand = Plus / Plus
Query: 388 ggccccgaggagcaccccatcaagttctcccaggcattccatttgctgccggcagctggg 447
||||||| ||||||||| | |||||||||||| ||||||||||||||||| | |||
Sbjct: 21 ggccccggcgagcacccccttaagttctcccagatgttccatttgctgccggctggaggg 80
Query: 448 tccttcttcgtgcagaatgacatgttccgcctgaactatgg 488
||||||| ||||||||| ||||||||||| |||||||||||
Sbjct: 81 tccttctacgtgcagaacgacatgttccggctgaactatgg 121
>gb|CN815413.1|CN815413 HRO4509_D05_G09ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4509_D05_G09, mRNA sequence
Length = 773
Score = 65.9 bits (33), Expect = 5e-011
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 314 tcgtcaccgtcgactgccagccgtcggggccccagggaggcatgctcgtcttcgtctccg 373
|||||||||||||||||||||| | || ||| ||| ||||||||||||||||||||||
Sbjct: 442 tcgtcaccgtcgactgccagcctgccggccccacgggcggcatgctcgtcttcgtctccg 383
Query: 374 g 374
|
Sbjct: 382 g 382
Score = 54.0 bits (27), Expect = 2e-007
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 450 cttcttcgtgcagaatgacatgttccgcctgaactatggctaa 492
||||| ||||||||| |||||||||||||| ||||| ||||||
Sbjct: 303 cttctacgtgcagaacgacatgttccgcctcaactacggctaa 261
>gb|CN815533.1|CN815533 HRO4512_F11_L22ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4512_F11_L22, mRNA sequence
Length = 545
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 99 cggcggcggcggcgagg 115
|||||||||||||||||
Sbjct: 334 cggcggcggcggcgagg 318
>gb|AF140554.1|AF140554 Avena sativa DNA-binding protein WRKY1 (wrky1) mRNA, complete cds
Length = 2073
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 99 cggcggcggcggcgagg 115
|||||||||||||||||
Sbjct: 1069 cggcggcggcggcgagg 1085
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1770
Number of Sequences: 8143
Number of extensions: 1770
Number of successful extensions: 547
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 537
Number of HSP's gapped (non-prelim): 9
length of query: 767
length of database: 4,702,463
effective HSP length: 16
effective length of query: 751
effective length of database: 4,572,175
effective search space: 3433703425
effective search space used: 3433703425
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)