BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2430769.2.1
(617 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN816276.1|CN816276 HRO4518_H08_O16ZS5 Lib AA071E1X Aven... 111 7e-025
dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-Co... 60 2e-009
>gb|CN816276.1|CN816276 HRO4518_H08_O16ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4518_H08_O16, mRNA sequence
Length = 372
Score = 111 bits (56), Expect = 7e-025
Identities = 110/128 (85%)
Strand = Plus / Minus
Query: 243 atcagacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 302
||||||||| ||| |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 128 atcagacgaggcgacggcagatggtgaccccatcggcgatggcgagctggcagacctcga 69
Query: 303 cgcggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggt 362
||| || || | |||| | ||||||| |||||||||||||||||||||||| ||
Sbjct: 68 tgcgcgggtcggcggcgagcctggcgttgaggtccctgatggcggcggagaacctggtgt 9
Query: 363 cgaggtcg 370
||||||||
Sbjct: 8 cgaggtcg 1
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase,
partial cds
Length = 622
Score = 60.0 bits (30), Expect = 2e-009
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 490 cttgtcggcgtcgacgaaggcgaagtcgaaggcgccggggttggcc 535
|||||| |||||||||||| |||||||||||| |||| ||||||||
Sbjct: 149 cttgtccgcgtcgacgaagacgaagtcgaaggtgccgtggttggcc 104
Score = 56.0 bits (28), Expect = 4e-008
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 252 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgcgg 307
|||||||||||| |||| ||||||| ||| || ||||||||||| ||||||||||
Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcgg 332
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1294
Number of Sequences: 8143
Number of extensions: 1294
Number of successful extensions: 376
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 371
Number of HSP's gapped (non-prelim): 5
length of query: 617
length of database: 4,702,463
effective HSP length: 16
effective length of query: 601
effective length of database: 4,572,175
effective search space: 2747877175
effective search space used: 2747877175
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)