BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2418861.2.1
(614 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN814661.1|CN814661 HRO4501_B06_C11ZS5 Lib AA071E1X Aven... 456 e-128
gb|CN814657.1|CN814657 HRO4501_B02_C03ZS5 Lib AA071E1X Aven... 34 0.14
>gb|CN814661.1|CN814661 HRO4501_B06_C11ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4501_B06_C11, mRNA sequence
Length = 842
Score = 456 bits (230), Expect = e-128
Identities = 381/430 (88%), Gaps = 1/430 (0%)
Strand = Plus / Plus
Query: 185 gtatgagaaatatcatggatactatggagggaaggaggaagcaaggaagtccaactatac 244
||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||| ||
Sbjct: 11 gtatgagaaatttc-tggatactacggagggaaggaggaagcaaggaagttcaactacac 69
Query: 245 tgatatggttaataaatactatgatcttgccactagcttctatgagtatggttggggtga 304
||||||||||||||||||||| |||||| | ||||||||||||||||| || ||||||||
Sbjct: 70 tgatatggttaataaatactacgatctttctactagcttctatgagtacggctggggtga 129
Query: 305 atccttccactttgctcacagatggaatggagaatccttacgtgaaagcatcaagcgaca 364
||| || |||||||||||||| |||||||| ||||| ||| | ||||||||||| |||||
Sbjct: 130 atcttttcactttgctcacaggtggaatggggaatctttaagggaaagcatcaaacgaca 189
Query: 365 tgagcattttcttgccctgcaacttggtttgaaaccaggaatgaaggttttagatgtggg 424
||||||||||| ||||| || |||| ||||||||||| ||||||||||| || |||||
Sbjct: 190 cgagcattttctggcccttcagcttgagttgaaaccagggatgaaggttttggacgtggg 249
Query: 425 ctgtggaataggtggaccactgagagaaattgcaagatttagctcaacttcagttaccgg 484
||||||||||||||||||| | ||||| ||||| |||||||||||||| |||||||||||
Sbjct: 250 ctgtggaataggtggaccattaagagagattgccagatttagctcaacctcagttaccgg 309
Query: 485 attgaataacaacgaataccagataaccaggggaaaggagctcaaccgtttagcaggaat 544
|||||| |||||||| || |||||||| ||||||||||||||||| ||| | |||||| |
Sbjct: 310 attgaacaacaacgactatcagataactaggggaaaggagctcaatcgtctggcaggact 369
Query: 545 tagtggaacatgtgattttgtcaaggcggacttcatgaagatgccgttcgatgacaacac 604
||||||||| ||||| ||||||||||| ||||||||||| ||||| ||| || |||||
Sbjct: 370 tagtggaacttgtgactttgtcaaggcagacttcatgaatatgcctttctccgataacac 429
Query: 605 ttttgatgct 614
||||||||||
Sbjct: 430 ttttgatgct 439
>gb|CN814657.1|CN814657 HRO4501_B02_C03ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4501_B02_C03, mRNA sequence
Length = 652
Score = 34.2 bits (17), Expect = 0.14
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 447 agagaaattgcaagatt 463
|||||||||||||||||
Sbjct: 319 agagaaattgcaagatt 335
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2969
Number of Sequences: 8143
Number of extensions: 2969
Number of successful extensions: 637
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 635
Number of HSP's gapped (non-prelim): 2
length of query: 614
length of database: 4,702,463
effective HSP length: 16
effective length of query: 598
effective length of database: 4,572,175
effective search space: 2734160650
effective search space used: 2734160650
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)