BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2404801.2.1
         (867 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF117889.1|AF117889  Avena fatua 40S ribosomal protein S3...    34   0.20 

>gb|AF117889.1|AF117889 Avena fatua 40S ribosomal protein S3A mRNA, partial cds
          Length = 382

 Score = 34.2 bits (17), Expect = 0.20
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 336 tgacctgcaggagctggtgca 356
           ||||||| |||||||||||||
Sbjct: 1   tgacctgaaggagctggtgca 21



  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1937
Number of Sequences: 8143
Number of extensions: 1937
Number of successful extensions: 558
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 557
Number of HSP's gapped (non-prelim): 1
length of query: 867
length of database: 4,702,463
effective HSP length: 16
effective length of query: 851
effective length of database: 4,572,175
effective search space: 3890920925
effective search space used: 3890920925
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)