BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192701.2.2
(654 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN816026.1|CN816026 HRO4516_A12_B24ZS5 Lib AA071E1X Aven... 76 4e-014
emb|AJ005502.1|ASA005502 Avena strigosa pAs111 repetitive D... 34 0.15
>gb|CN816026.1|CN816026 HRO4516_A12_B24ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4516_A12_B24, mRNA sequence
Length = 609
Score = 75.8 bits (38), Expect = 4e-014
Identities = 47/50 (94%)
Strand = Plus / Plus
Query: 386 tgcccctgctacaacaactggaaaaccaaggaaggagggcccaagtgccc 435
||||||||||||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 26 tgcccctgctacaacaactggaagaccaaggagggaggacccaagtgccc 75
>emb|AJ005502.1|ASA005502 Avena strigosa pAs111 repetitive DNA sequence
Length = 619
Score = 34.2 bits (17), Expect = 0.15
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 118 cttcctgttgctcgcatccct 138
||||||||||| |||||||||
Sbjct: 428 cttcctgttgcgcgcatccct 448
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1450
Number of Sequences: 8143
Number of extensions: 1450
Number of successful extensions: 395
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 392
Number of HSP's gapped (non-prelim): 3
length of query: 654
length of database: 4,702,463
effective HSP length: 16
effective length of query: 638
effective length of database: 4,572,175
effective search space: 2917047650
effective search space used: 2917047650
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)