BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161072.2.1
(1197 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN814756.1|CN814756 HRO4502_B07_C14ZS5 Lib AA071E1X Aven... 274 2e-073
gb|CN817035.1|CN817035 HRO4527_E07_J13ZS5 Lib AA071E1X Aven... 131 2e-030
gb|AB128046.1|AB128046 AB128046 Avena sativa leaf 7-day-old... 48 2e-005
gb|CN821598.1|CN821598 HRO4408_B04_D08ZS5 Lib AA069E1X Aven... 46 7e-005
gb|BE439042.1|BE439042 CDO215_WHE2D0041F ITEC CDO Oat cDNA ... 44 3e-004
gb|CN815319.1|CN815319 HRO4508_D04_H08ZS5 Lib AA071E1X Aven... 42 0.001
gb|AF237544.1| Avena sativa receptor-like kinase extracellu... 38 0.018
gb|CN815048.1|CN815048 HRO4505_C09_E17ZS5 Lib AA071E1X Aven... 34 0.27
>gb|CN814756.1|CN814756 HRO4502_B07_C14ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4502_B07_C14, mRNA sequence
Length = 620
Score = 274 bits (138), Expect = 2e-073
Identities = 264/306 (86%)
Strand = Plus / Minus
Query: 358 gttgatgggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccacgag 417
|||||||||||| |||| ||||| |||||||||||||||||| ||||||||||| | |||
Sbjct: 333 gttgatgggcaggggctcgccgttccactccttgaggcactccagcatggggtcgatgag 274
Query: 418 cttgccctggctgatgccgacgaacaccttgttgcactcctcgccgggggacttgagcct 477
|||||||||||||||||| | ||||||||||||||||||||||||||||||| ||| |
Sbjct: 273 cttgccctggctgatgcccaggaacaccttgttgcactcctcgccgggggacaggagttt 214
Query: 478 ctcgccggtcaggaacacgcagccgagctcctcgcgcacgaagcggtacagcgggaacga 537
||||||||| ||| |||||||||| ||||||||||| |||||||||||||||||||| ||
Sbjct: 213 ctcgccggtgaggtacacgcagcccagctcctcgcggacgaagcggtacagcgggaaaga 154
Query: 538 ccggctgtccgcgatccggttcgccacgggggcggtgccctcggcgaccgccacgcgggc 597
|| ||| ||| |||| |||||| | || |||||||| ||| || ||||||||
Sbjct: 153 cctgctctccttgatcaggttcgggatcggcgcggtgccggtctcgaaggcgacgcgggc 94
Query: 598 ggcctccacctcctggggcagcaccgcgcggagctcctcctcgaacctggtgatcttgga 657
|||||| | |||| |||||||| ||| ||| ||||||||||||||| |||||||||||||
Sbjct: 93 ggcctcgatctcccggggcagcgccgagcgcagctcctcctcgaacttggtgatcttgga 34
Query: 658 gaacac 663
||||||
Sbjct: 33 gaacac 28
>gb|CN817035.1|CN817035 HRO4527_E07_J13ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4527_E07_J13, mRNA sequence
Length = 418
Score = 131 bits (66), Expect = 2e-030
Identities = 93/102 (91%)
Strand = Plus / Minus
Query: 358 gttgatgggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccacgag 417
|||||||||||| |||| ||||| |||||||||||||||||| ||||||||||| | |||
Sbjct: 112 gttgatgggcaggggctcgccgttccactccttgaggcactccagcatggggtcgatgag 53
Query: 418 cttgccctggctgatgccgacgaacaccttgttgcactcctc 459
|||||||||||||||||| | |||||||| ||||||||||||
Sbjct: 52 cttgccctggctgatgcccaggaacacctagttgcactcctc 11
>gb|AB128046.1|AB128046 AB128046 Avena sativa leaf 7-day-old Avena sativa cDNA clone VRG86,
mRNA sequence
Length = 936
Score = 48.1 bits (24), Expect = 2e-005
Identities = 69/84 (82%)
Strand = Plus / Plus
Query: 365 ggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccacgagcttgccc 424
||||| |||| ||||| |||||||||||||||||| |||| | ||| | | ||||||||
Sbjct: 283 ggcagtggctcgccgttccactccttgaggcactcaagcagcgcgtcgatgtgcttgccc 342
Query: 425 tggctgatgccgacgaacaccttg 448
||| | ||| | || |||||||||
Sbjct: 343 tggttcatggcaacaaacaccttg 366
>gb|CN821598.1|CN821598 HRO4408_B04_D08ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4408_B04_D08, mRNA
sequence
Length = 371
Score = 46.1 bits (23), Expect = 7e-005
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 365 ggcagcggcttgccgtcccactccttgaggcactc 399
||||| |||| ||||| ||||||||||||||||||
Sbjct: 44 ggcaggggctcgccgttccactccttgaggcactc 10
>gb|BE439042.1|BE439042 CDO215_WHE2D0041F ITEC CDO Oat cDNA Library Avena sativa cDNA clone
CDO215_WHE2D0041, mRNA sequence
Length = 341
Score = 44.1 bits (22), Expect = 3e-004
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 371 ggcttgccgtcccactccttgaggcactcgagca 404
|||| ||||| |||||||||||||||||| ||||
Sbjct: 279 ggctcgccgttccactccttgaggcactccagca 312
>gb|CN815319.1|CN815319 HRO4508_D04_H08ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4508_D04_H08, mRNA sequence
Length = 417
Score = 42.1 bits (21), Expect = 0.001
Identities = 60/73 (82%)
Strand = Plus / Minus
Query: 377 ccgtcccactccttgaggcactcgagcatggggtccacgagcttgccctggctgatgccg 436
|||| |||||||||||||||||| |||| | ||| | | ||||||||| | | ||| |
Sbjct: 95 ccgttccactccttgaggcactcaagcagagcgtcgatgtgcttgcccttgttcatggca 36
Query: 437 acgaacaccttgt 449
|||||||||||||
Sbjct: 35 acgaacaccttgt 23
>gb|AF237544.1| Avena sativa receptor-like kinase extracellular domain rlk6a6
pseudogene, complete sequence
Length = 769
Score = 38.2 bits (19), Expect = 0.018
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 198 cacacacgcacgcacacat 216
|||||||||||||||||||
Sbjct: 243 cacacacgcacgcacacat 225
>gb|CN815048.1|CN815048 HRO4505_C09_E17ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4505_C09_E17, mRNA sequence
Length = 512
Score = 34.2 bits (17), Expect = 0.27
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 198 cacacacgcacgcacac 214
|||||||||||||||||
Sbjct: 434 cacacacgcacgcacac 418
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3037
Number of Sequences: 8143
Number of extensions: 3037
Number of successful extensions: 969
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 957
Number of HSP's gapped (non-prelim): 11
length of query: 1197
length of database: 4,702,463
effective HSP length: 16
effective length of query: 1181
effective length of database: 4,572,175
effective search space: 5399738675
effective search space used: 5399738675
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)