BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1716365.2.1
(936 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN819412.1|CN819412 HRO4405_G02_M03ZS5 Lib AA069E1X Aven... 192 4e-049
gb|CN820255.1|CN820255 HRO4417_C09_E17ZS5 Lib AA069E1X Aven... 36 0.054
>gb|CN819412.1|CN819412 HRO4405_G02_M03ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4405_G02_M03, mRNA
sequence
Length = 544
Score = 192 bits (97), Expect = 4e-049
Identities = 166/185 (89%), Gaps = 3/185 (1%)
Strand = Plus / Minus
Query: 333 cgagggatctcaactggcttggggatatcaggtggagtggcacacctgattaatgcccaa 392
||||||||||||||||||||||||||||| || |||||||||||||| || ||||||||
Sbjct: 187 cgagggatctcaactggcttggggatatctggaggagtggcacaccttatcaatgcccag 128
Query: 393 ttaacaccttcaaagaacgggtgctgttttatttctgtggctccacgcttatacgctaat 452
||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 127 ttaacaccttcaaagaaggggtgctgctttatttctgtggctccacgcttgtacgccaac 68
Query: 453 cgatgctgaggttccttgatgagcaatcccctaataagatcccttgcagcaaaactcact 512
||||| || || ||||| ||||||||||||| |||||||||| ||||||||||| |||
Sbjct: 67 cgatg-tgtggctcctt-atgagcaatccccgtataagatccc-tgcagcaaaacccacg 11
Query: 513 acagg 517
|||||
Sbjct: 10 acagg 6
Score = 34.2 bits (17), Expect = 0.21
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 157 catctacatataaagttatta 177
||||||||||| |||||||||
Sbjct: 360 catctacatatcaagttatta 340
>gb|CN820255.1|CN820255 HRO4417_C09_E17ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4417_C09_E17, mRNA
sequence
Length = 649
Score = 36.2 bits (18), Expect = 0.054
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 836 gcatgtggttgtcgtgac 853
||||||||||||||||||
Sbjct: 210 gcatgtggttgtcgtgac 227
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2717
Number of Sequences: 8143
Number of extensions: 2717
Number of successful extensions: 760
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 754
Number of HSP's gapped (non-prelim): 4
length of query: 936
length of database: 4,702,463
effective HSP length: 16
effective length of query: 920
effective length of database: 4,572,175
effective search space: 4206401000
effective search space used: 4206401000
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)