BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1716207.2.2
         (754 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN817045.1|CN817045  HRO4527_F05_L09ZS5 Lib AA071E1X Aven...    62   8e-010
gb|CN815113.1|CN815113  HRO4506_A05_A10ZS5 Lib AA071E1X Aven...    46   5e-005

>gb|CN817045.1|CN817045 HRO4527_F05_L09ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4527_F05_L09, mRNA sequence
          Length = 391

 Score = 61.9 bits (31), Expect = 8e-010
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 342 atggtctcggtccactcaagccagcagatctacaccagggcaaccaa 388
           ||||||||| | ||||| ||||||||||||||||||||||| |||||
Sbjct: 9   atggtctcgattcactcgagccagcagatctacaccagggcgaccaa 55



>gb|CN815113.1|CN815113 HRO4506_A05_A10ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4506_A05_A10, mRNA sequence
          Length = 226

 Score = 46.1 bits (23), Expect = 5e-005
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 360 agccagcagatctacaccagggc 382
           |||||||||||||||||||||||
Sbjct: 26  agccagcagatctacaccagggc 48



  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2098
Number of Sequences: 8143
Number of extensions: 2098
Number of successful extensions: 574
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 570
Number of HSP's gapped (non-prelim): 4
length of query: 754
length of database: 4,702,463
effective HSP length: 16
effective length of query: 738
effective length of database: 4,572,175
effective search space: 3374265150
effective search space used: 3374265150
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)