BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131584.2.3
(687 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN818166.1|CN818166 HRO4471_C12_E23ZS5 Lib AA070E1X Aven... 198 5e-051
gb|CN818609.1|CN818609 HRO4467_C02_E03ZS5 Lib AA070E1X Aven... 176 2e-044
>gb|CN818166.1|CN818166 HRO4471_C12_E23ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4471_C12_E23, mRNA sequence
Length = 475
Score = 198 bits (100), Expect = 5e-051
Identities = 187/216 (86%)
Strand = Plus / Minus
Query: 292 tcacttggggttcctcagcacgatgatgaccgagtcgcccctgaggaacatcttgctgat 351
|||||| ||||||||||| || |||||||||||||| || | ||||||||||||||||||
Sbjct: 220 tcacttcgggttcctcagaacaatgatgaccgagtctccgcggaggaacatcttgctgat 161
Query: 352 gaatctatccttgttcacaggcagagccttctttttgcccttgccagtcttggggacctc 411
||| || |||||||||||||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 160 gaacctgtccttgttcacaggaagagccttcttcttgcctttcccagtctttggaacctc 101
Query: 412 tgtccacatctcccgcacgttctcgagcaccatgttacagtggcgatcaaaagcacgaac 471
||||||||||||| |||||||| || |||||||| |||||||||||||| || | ||
Sbjct: 100 ggtccacatctccctaacgttctcaagaaccatgttgcagtggcgatcaaatgccctcac 41
Query: 472 ccggccaagcagcttcttgttgttgcggcaattgat 507
|||||||| | |||||||||||| ||||| |||||
Sbjct: 40 gcggccaagtaacttcttgttgttccggcagttgat 5
>gb|CN818609.1|CN818609 HRO4467_C02_E03ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4467_C02_E03, mRNA sequence
Length = 463
Score = 176 bits (89), Expect = 2e-044
Identities = 191/225 (84%)
Strand = Plus / Minus
Query: 292 tcacttggggttcctcagcacgatgatgaccgagtcgcccctgaggaacatcttgctgat 351
|||||| |||||||| || || |||||||| ||||| || | ||||||||||||||||||
Sbjct: 229 tcactttgggttcctgaggacaatgatgacagagtccccgcggaggaacatcttgctgat 170
Query: 352 gaatctatccttgttcacaggcagagccttctttttgcccttgccagtcttggggacctc 411
||| || ||||||||||| || ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 169 gaacctgtccttgttcactggaagagccttcttcttgcctttgccagtctttgggacctc 110
Query: 412 tgtccacatctcccgcacgttctcgagcaccatgttacagtggcgatcaaaagcacgaac 471
||||||||||||| |||||||| || |||||||| ||||| ||||| || || | ||
Sbjct: 109 agtccacatctccctaacgttctcaagaaccatgttgcagtgacgatcgaatgccctcac 50
Query: 472 ccggccaagcagcttcttgttgttgcggcaattgatgagaacctg 516
|||||||| | |||||||||||| ||||| ||||| || |||||
Sbjct: 49 gcggccaagtaacttcttgttgttccggcagttgataagcacctg 5
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1545
Number of Sequences: 8143
Number of extensions: 1545
Number of successful extensions: 442
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 440
Number of HSP's gapped (non-prelim): 2
length of query: 687
length of database: 4,702,463
effective HSP length: 16
effective length of query: 671
effective length of database: 4,572,175
effective search space: 3067929425
effective search space used: 3067929425
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)