BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCL24b11.yg.2.1
         (520 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AV529364.1|AV529364  AV529364 Arabidopsis thaliana aboveg...    40   0.37 
emb|AJ529354.1|ATH529354  Arabidopsis thaliana T-DNA flankin...    40   0.37 
ref|NM_123785.1|  Arabidopsis thaliana transcription factor ...    40   0.37 

>gb|AV529364.1|AV529364 AV529364 Arabidopsis thaliana aboveground organs two to six-week
           old Arabidopsis thaliana cDNA clone APZL34g11R 5', mRNA
           sequence
          Length = 503

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 417 cgcccttgaggaacgggtggaggt 440
           |||||||||||||||| |||||||
Sbjct: 266 cgcccttgaggaacggttggaggt 289



>emb|AJ529354.1|ATH529354 Arabidopsis thaliana T-DNA flanking sequence, left border, clone
          185E03
          Length = 78

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 46 tctcaatatctacaacagtc 65
          ||||||||||||||||||||
Sbjct: 68 tctcaatatctacaacagtc 49



>ref|NM_123785.1| Arabidopsis thaliana transcription factor AT5G44180 mRNA, complete
            cds
          Length = 5224

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 417  cgcccttgaggaacgggtggaggt 440
            |||||||||||||||| |||||||
Sbjct: 2814 cgcccttgaggaacggttggaggt 2837



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 265,064
Number of Sequences: 1013581
Number of extensions: 265064
Number of successful extensions: 24063
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24060
Number of HSP's gapped (non-prelim): 3
length of query: 520
length of database: 908,940,872
effective HSP length: 20
effective length of query: 500
effective length of database: 888,669,252
effective search space: 444334626000
effective search space used: 444334626000
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)