BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.006E19F020311.3.1
(789 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 60 6e-007
emb|AL049746.1|ATT23J7 Arabidopsis thaliana DNA chromosome ... 60 6e-007
ref|NM_114643.3| Arabidopsis thaliana ATATH3; ATPase, coupl... 60 6e-007
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 60 6e-007
ref|NM_114644.2| Arabidopsis thaliana ATATH4; ATPase, coupl... 52 1e-004
gb|AY099665.1| Arabidopsis thaliana ABC-type transport prot... 46 0.009
ref|NM_114647.3| Arabidopsis thaliana ATATH7; ATPase, coupl... 46 0.009
ref|NM_114645.2| Arabidopsis thaliana ATATH5; ATPase, coupl... 44 0.036
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 60.0 bits (30), Expect = 6e-007
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 17572405 tggtgtatgagaagcagcagcatctaagaattataatgaaaatgca 17572450
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | |||| ||||| |||||||||||
Sbjct: 17578247 tggtgtatgagaagcagcagcatttaagaattataatgaaaatgca 17578292
Score = 46.1 bits (23), Expect = 0.009
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||| || |||| | |||| || ||||||||||||||
Sbjct: 17595250 ctggtgtatgagaaacaacagaggttaagaatcatgatgaaaatgca 17595296
Score = 44.1 bits (22), Expect = 0.036
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||| ||||||||||||||| ||||| ||||| |||||||||||
Sbjct: 17584232 tggtctatgagaagcagcagcgtctaagaattataatgaaaatgca 17584277
>emb|AL049746.1|ATT23J7 Arabidopsis thaliana DNA chromosome 3, BAC clone T23J7
Length = 92493
Score = 60.0 bits (30), Expect = 6e-007
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 32523 tggtgtatgagaagcagcagcatctaagaattataatgaaaatgca 32568
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | |||| ||||| |||||||||||
Sbjct: 38365 tggtgtatgagaagcagcagcatttaagaattataatgaaaatgca 38410
Score = 46.1 bits (23), Expect = 0.009
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||| || |||| | |||| || ||||||||||||||
Sbjct: 55368 ctggtgtatgagaaacaacagaggttaagaatcatgatgaaaatgca 55414
Score = 44.1 bits (22), Expect = 0.036
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||| ||||||||||||||| ||||| ||||| |||||||||||
Sbjct: 44350 tggtctatgagaagcagcagcgtctaagaattataatgaaaatgca 44395
>ref|NM_114643.3| Arabidopsis thaliana ATATH3; ATPase, coupled to transmembrane
movement of substances AT3G47750 (ATATH3) mRNA, complete
cds
Length = 2835
Score = 60.0 bits (30), Expect = 6e-007
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 1082 tggtgtatgagaagcagcagcatctaagaattataatgaaaatgca 1127
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 60.0 bits (30), Expect = 6e-007
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 17619343 tggtgtatgagaagcagcagcatctaagaattataatgaaaatgca 17619388
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | |||| ||||| |||||||||||
Sbjct: 17625185 tggtgtatgagaagcagcagcatttaagaattataatgaaaatgca 17625230
Score = 46.1 bits (23), Expect = 0.009
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||| || |||| | |||| || ||||||||||||||
Sbjct: 17642188 ctggtgtatgagaaacaacagaggttaagaatcatgatgaaaatgca 17642234
Score = 44.1 bits (22), Expect = 0.036
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||| ||||||||||||||| ||||| ||||| |||||||||||
Sbjct: 17631170 tggtctatgagaagcagcagcgtctaagaattataatgaaaatgca 17631215
>ref|NM_114644.2| Arabidopsis thaliana ATATH4; ATPase, coupled to transmembrane
movement of substances AT3G47760 (ATATH4) mRNA, complete
cds
Length = 2619
Score = 52.0 bits (26), Expect = 1e-004
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||||||||| | |||| ||||| |||||||||||
Sbjct: 986 tggtgtatgagaagcagcagcatttaagaattataatgaaaatgca 1031
>gb|AY099665.1| Arabidopsis thaliana ABC-type transport protein-like protein
(At3g47790) mRNA, complete cds
Length = 2959
Score = 46.1 bits (23), Expect = 0.009
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||| || |||| | |||| || ||||||||||||||
Sbjct: 1068 ctggtgtatgagaaacaacagaggttaagaatcatgatgaaaatgca 1114
>ref|NM_114647.3| Arabidopsis thaliana ATATH7; ATPase, coupled to transmembrane
movement of substances AT3G47790 (ATATH7) mRNA, complete
cds
Length = 2960
Score = 46.1 bits (23), Expect = 0.009
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||||||||||||| || |||| | |||| || ||||||||||||||
Sbjct: 1069 ctggtgtatgagaaacaacagaggttaagaatcatgatgaaaatgca 1115
>ref|NM_114645.2| Arabidopsis thaliana ATATH5; ATPase, coupled to transmembrane
movement of substances AT3G47770 (ATATH5) mRNA, complete
cds
Length = 2703
Score = 44.1 bits (22), Expect = 0.036
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 495 tggtgtatgagaagcagcagaagctaaggattatgatgaaaatgca 540
|||| ||||||||||||||| ||||| ||||| |||||||||||
Sbjct: 998 tggtctatgagaagcagcagcgtctaagaattataatgaaaatgca 1043
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 490,066
Number of Sequences: 1013581
Number of extensions: 490066
Number of successful extensions: 36320
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35868
Number of HSP's gapped (non-prelim): 452
length of query: 789
length of database: 908,940,872
effective HSP length: 20
effective length of query: 769
effective length of database: 888,669,252
effective search space: 683386654788
effective search space used: 683386654788
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)