BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBS7b05.xg.2.1
(526 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|T20516.1|T20516 2524 Lambda-PRL2 Arabidopsis thaliana cD... 86 7e-015
gb|AV782576.1|AV782576 AV782576 RAFL4 Arabidopsis thaliana ... 86 7e-015
gb|AV523139.1|AV523139 AV523139 Arabidopsis thaliana aboveg... 86 7e-015
gb|AV538027.1|AV538027 AV538027 Arabidopsis thaliana roots ... 86 7e-015
gb|AV546309.1|AV546309 AV546309 Arabidopsis thaliana roots ... 86 7e-015
gb|AV546311.1|AV546311 AV546311 Arabidopsis thaliana roots ... 86 7e-015
gb|AV546312.1|AV546312 AV546312 Arabidopsis thaliana roots ... 86 7e-015
gb|AV552905.1|AV552905 AV552905 Arabidopsis thaliana roots ... 86 7e-015
gb|CK121679.1|CK121679 202d06.p1 AtM1 Arabidopsis thaliana ... 86 7e-015
gb|AF027172.1|AF027172 Arabidopsis thaliana cellulose synth... 86 7e-015
dbj|BD022673.1| Manipulation of cellulose and/or beta-1,4-g... 86 7e-015
dbj|BD022674.1| Manipulation of cellulose and/or beta-1,4-g... 86 7e-015
dbj|BD022676.1| Manipulation of cellulose and/or beta-1,4-g... 86 7e-015
dbj|BD022679.1| Manipulation of cellulose and/or beta-1,4-g... 86 7e-015
emb|AX030938.1| Sequence 1 from Patent WO9800549 86 7e-015
emb|AX030940.1| Sequence 3 from Patent WO9800549 86 7e-015
emb|AX030942.1| Sequence 5 from Patent WO9800549 86 7e-015
emb|AX030948.1| Sequence 11 from Patent WO9800549 86 7e-015
gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R1... 86 7e-015
emb|BX827280.1|CNS0A2E6 Arabidopsis thaliana Full-length cD... 86 7e-015
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 86 7e-015
emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4... 86 7e-015
emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosom... 86 7e-015
dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose syn... 86 7e-015
ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNT... 86 7e-015
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 86 7e-015
gb|AV562949.1|AV562949 AV562949 Arabidopsis thaliana green ... 78 2e-012
emb|BX829135.1|CNS0A3FB Arabidopsis thaliana Full-length cD... 78 2e-012
gb|AV442267.1|AV442267 AV442267 Arabidopsis thaliana above-... 72 1e-010
gb|AV546043.1|AV546043 AV546043 Arabidopsis thaliana roots ... 72 1e-010
gb|BE038216.1|BE038216 AA10E02 AA Arabidopsis thaliana cDNA... 66 6e-009
gb|AV823492.1|AV823492 AV823492 RAFL5 Arabidopsis thaliana ... 66 6e-009
gb|AV523438.1|AV523438 AV523438 Arabidopsis thaliana aboveg... 66 6e-009
gb|AV523533.1|AV523533 AV523533 Arabidopsis thaliana aboveg... 66 6e-009
gb|AV523635.1|AV523635 AV523635 Arabidopsis thaliana aboveg... 66 6e-009
gb|AV530046.1|AV530046 AV530046 Arabidopsis thaliana aboveg... 66 6e-009
gb|AV546683.1|AV546683 AV546683 Arabidopsis thaliana roots ... 66 6e-009
gb|AV547198.1|AV547198 AV547198 Arabidopsis thaliana roots ... 66 6e-009
gb|BP582979.1|BP582979 BP582979 RAFL14 Arabidopsis thaliana... 66 6e-009
gb|BP614740.1|BP614740 BP614740 RAFL16 Arabidopsis thaliana... 66 6e-009
gb|BP617268.1|BP617268 BP617268 RAFL16 Arabidopsis thaliana... 66 6e-009
gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synth... 66 6e-009
dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-g... 66 6e-009
gb|AY045960.1| Arabidopsis thaliana putative cellulose synt... 66 6e-009
emb|AX030946.1| Sequence 9 from Patent WO9800549 66 6e-009
gb|BT002335.1| Arabidopsis thaliana clone C104938 putative ... 66 6e-009
emb|BX833092.1|CNS0A0FM Arabidopsis thaliana Full-length cD... 66 6e-009
emb|BX833785.1|CNS0A0C4 Arabidopsis thaliana Full-length cD... 66 6e-009
dbj|AB018111.1| Arabidopsis thaliana genomic DNA, chromosom... 66 6e-009
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 66 6e-009
ref|NM_120599.2| Arabidopsis thaliana CESA3 (CELLULASE SYNT... 66 6e-009
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 66 6e-009
gb|AV523143.1|AV523143 AV523143 Arabidopsis thaliana aboveg... 64 3e-008
gb|AV537459.1|AV537459 AV537459 Arabidopsis thaliana roots ... 64 3e-008
gb|BP791873.1|BP791873 BP791873 RAFL7 Arabidopsis thaliana ... 64 3e-008
gb|AV560817.1|AV560817 AV560817 Arabidopsis thaliana green ... 62 1e-007
gb|AV794366.1|AV794366 AV794366 RAFL8 Arabidopsis thaliana ... 58 2e-006
gb|T45311.1|T45311 8574 Lambda-PRL2 Arabidopsis thaliana cD... 56 6e-006
gb|AV812779.1|AV812779 AV812779 RAFL9 Arabidopsis thaliana ... 56 6e-006
gb|BP602576.1|BP602576 BP602576 RAFL16 Arabidopsis thaliana... 56 6e-006
gb|AV545922.1|AV545922 AV545922 Arabidopsis thaliana roots ... 54 2e-005
gb|BP615997.1|BP615997 BP615997 RAFL16 Arabidopsis thaliana... 54 2e-005
gb|AV806463.1|AV806463 AV806463 RAFL9 Arabidopsis thaliana ... 52 1e-004
gb|AV806728.1|AV806728 AV806728 RAFL9 Arabidopsis thaliana ... 52 1e-004
gb|AV523011.1|AV523011 AV523011 Arabidopsis thaliana aboveg... 52 1e-004
gb|AV523221.1|AV523221 AV523221 Arabidopsis thaliana aboveg... 52 1e-004
gb|AV523497.1|AV523497 AV523497 Arabidopsis thaliana aboveg... 52 1e-004
gb|AV544042.1|AV544042 AV544042 Arabidopsis thaliana roots ... 52 1e-004
gb|AV545907.1|AV545907 AV545907 Arabidopsis thaliana roots ... 52 1e-004
gb|AV546317.1|AV546317 AV546317 Arabidopsis thaliana roots ... 52 1e-004
gb|BP581479.1|BP581479 BP581479 RAFL14 Arabidopsis thaliana... 52 1e-004
gb|BP602343.1|BP602343 BP602343 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP608218.1|BP608218 BP608218 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP616599.1|BP616599 BP616599 RAFL16 Arabidopsis thaliana... 52 1e-004
gb|BP640849.1|BP640849 BP640849 RAFL19 Arabidopsis thaliana... 52 1e-004
gb|BP669023.1|BP669023 BP669023 RAFL21 Arabidopsis thaliana... 52 1e-004
gb|AV529339.1|AV529339 AV529339 Arabidopsis thaliana aboveg... 50 4e-004
gb|AV544576.1|AV544576 AV544576 Arabidopsis thaliana roots ... 50 4e-004
gb|AV548631.1|AV548631 AV548631 Arabidopsis thaliana roots ... 50 4e-004
gb|AV554955.1|AV554955 AV554955 Arabidopsis thaliana roots ... 50 4e-004
gb|BP598870.1|BP598870 BP598870 RAFL16 Arabidopsis thaliana... 50 4e-004
gb|BP612153.1|BP612153 BP612153 RAFL16 Arabidopsis thaliana... 50 4e-004
gb|BP619693.1|BP619693 BP619693 RAFL16 Arabidopsis thaliana... 50 4e-004
gb|BP660707.1|BP660707 BP660707 RAFL21 Arabidopsis thaliana... 50 4e-004
gb|BP783578.1|BP783578 BP783578 RAFL7 Arabidopsis thaliana ... 50 4e-004
gb|BP791328.1|BP791328 BP791328 RAFL7 Arabidopsis thaliana ... 50 4e-004
gb|AV547280.1|AV547280 AV547280 Arabidopsis thaliana roots ... 48 0.002
gb|BP620189.1|BP620189 BP620189 RAFL16 Arabidopsis thaliana... 48 0.002
gb|BP643407.1|BP643407 BP643407 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP620086.1|BP620086 BP620086 RAFL16 Arabidopsis thaliana... 46 0.006
gb|AV523377.1|AV523377 AV523377 Arabidopsis thaliana aboveg... 44 0.024
gb|AV523450.1|AV523450 AV523450 Arabidopsis thaliana aboveg... 44 0.024
gb|BP641805.1|BP641805 BP641805 RAFL19 Arabidopsis thaliana... 42 0.094
gb|AI994106.1|AI994106 701498975 A. thaliana, Ohio State cl... 40 0.37
gb|AV803379.1|AV803379 AV803379 RAFL9 Arabidopsis thaliana ... 40 0.37
gb|AV812648.1|AV812648 AV812648 RAFL9 Arabidopsis thaliana ... 40 0.37
gb|AV816808.1|AV816808 AV816808 RAFL9 Arabidopsis thaliana ... 40 0.37
gb|AV539863.1|AV539863 AV539863 Arabidopsis thaliana roots ... 40 0.37
gb|AV548122.1|AV548122 AV548122 Arabidopsis thaliana roots ... 40 0.37
gb|AV559974.1|AV559974 AV559974 Arabidopsis thaliana green ... 40 0.37
gb|AV560162.1|AV560162 AV560162 Arabidopsis thaliana green ... 40 0.37
gb|AV564636.1|AV564636 AV564636 Arabidopsis thaliana green ... 40 0.37
gb|AV566035.1|AV566035 AV566035 Arabidopsis thaliana green ... 40 0.37
gb|BP587323.1|BP587323 BP587323 RAFL15 Arabidopsis thaliana... 40 0.37
gb|BP643870.1|BP643870 BP643870 RAFL19 Arabidopsis thaliana... 40 0.37
gb|BP651689.1|BP651689 BP651689 RAFL19 Arabidopsis thaliana... 40 0.37
gb|BP661871.1|BP661871 BP661871 RAFL21 Arabidopsis thaliana... 40 0.37
gb|BP777777.1|BP777777 BP777777 RAFL7 Arabidopsis thaliana ... 40 0.37
gb|BP787110.1|BP787110 BP787110 RAFL7 Arabidopsis thaliana ... 40 0.37
gb|BP791204.1|BP791204 BP791204 RAFL7 Arabidopsis thaliana ... 40 0.37
gb|BP791266.1|BP791266 BP791266 RAFL7 Arabidopsis thaliana ... 40 0.37
gb|BP793142.1|BP793142 BP793142 RAFL7 Arabidopsis thaliana ... 40 0.37
gb|AF091713.1|AF091713 Arabidopsis thaliana cellulose synth... 40 0.37
gb|AF088917.1|AF088917 Arabidopsis thaliana cellulose synth... 40 0.37
gb|AY139754.1| Arabidopsis thaliana AT5g17420/T10B6_80 mRNA... 40 0.37
gb|BT004543.1| Arabidopsis thaliana AT5g17420/T10B6_80 gene... 40 0.37
emb|BX833894.1|CNS0A0M2 Arabidopsis thaliana Full-length cD... 40 0.37
emb|AL391142.1|ATT10B6 Arabidopsis thaliana DNA chromosome ... 40 0.37
dbj|AK220815.1| Arabidopsis thaliana mRNA for cellulose syn... 40 0.37
ref|NM_121747.2| Arabidopsis thaliana unknown protein AT5G1... 40 0.37
ref|NM_180507.1| Arabidopsis thaliana unknown protein AT5G1... 40 0.37
ref|NM_121748.2| Arabidopsis thaliana IRX3 (IRREGULAR XYLEM... 40 0.37
>gb|T20516.1|T20516 2524 Lambda-PRL2 Arabidopsis thaliana cDNA clone 86B7T7A, mRNA
sequence
Length = 425
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 120 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 179
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 180 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 239
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 240 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 298
>gb|AV782576.1|AV782576 AV782576 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-19-E02 3',
mRNA sequence
Length = 627
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 387 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 446
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 447 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 506
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 507 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 565
>gb|AV523139.1|AV523139 AV523139 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL17g05F 3', mRNA
sequence
Length = 601
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 342 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 401
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 402 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 461
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 462 tgggcaataacccataaggcgaagaagagctttccgaaaagcggaccccacgactggta 520
>gb|AV538027.1|AV538027 AV538027 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ109c04F 3', mRNA sequence
Length = 595
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 299 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 358
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 359 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 418
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 419 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 477
>gb|AV546309.1|AV546309 AV546309 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL11g12F 3', mRNA sequence
Length = 602
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 387 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 446
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 447 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 506
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 507 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 565
>gb|AV546311.1|AV546311 AV546311 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL11h06F 3', mRNA sequence
Length = 596
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 387 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 446
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 447 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 506
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 507 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 565
>gb|AV546312.1|AV546312 AV546312 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL11h08F 3', mRNA sequence
Length = 603
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 405 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 464
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 465 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 524
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 525 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 583
>gb|AV552905.1|AV552905 AV552905 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ48e11R 5', mRNA sequence
Length = 528
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 325 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 266
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 265 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 206
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 205 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 147
>gb|CK121679.1|CK121679 202d06.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011D06202
5-PRIME, mRNA sequence
Length = 799
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 683 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 624
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 623 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 564
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 563 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 505
>gb|AF027172.1|AF027172 Arabidopsis thaliana cellulose synthase catalytic subunit (RSW1)
gene, complete cds
Length = 8401
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 7610 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 7551
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 7550 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 7491
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 7490 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 7432
>dbj|BD022673.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 2248
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 1835 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 1776
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 1775 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 1716
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 1715 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 1657
>dbj|BD022674.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 8411
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 7620 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 7561
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 7560 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 7501
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 7500 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 7442
>dbj|BD022676.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3603
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3191 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3132
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3131 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3072
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3071 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3013
>dbj|BD022679.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3673
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3261 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3202
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3201 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3142
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3141 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3083
>emb|AX030938.1| Sequence 1 from Patent WO9800549
Length = 2248
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 1835 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 1776
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 1775 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 1716
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 1715 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 1657
>emb|AX030940.1| Sequence 3 from Patent WO9800549
Length = 8411
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 7620 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 7561
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 7560 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 7501
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 7500 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 7442
>emb|AX030942.1| Sequence 5 from Patent WO9800549
Length = 3603
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3191 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3132
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3131 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3072
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3071 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3013
>emb|AX030948.1| Sequence 11 from Patent WO9800549
Length = 3673
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3261 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3202
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3201 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3142
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3141 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3083
>gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R19778) putative cellulose
synthase catalytic subunit (RSW1) (At4g32410) mRNA,
complete cds
Length = 3763
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3335 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3276
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3275 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3216
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3215 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3157
>emb|BX827280.1|CNS0A2E6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS32ZA11 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 832
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 447 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 388
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 387 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 328
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 327 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 269
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 11553845 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 11553904
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 11553905 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 11553964
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 11553965 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 11554023
>emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4, BAC clone F8B4 (ESSA project)
Length = 93257
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 41356 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 41415
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 41416 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 41475
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 41476 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 41534
>emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 77
Length = 197252
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 55073 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 55132
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 55133 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 55192
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 55193 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 55251
>dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit,
complete cds, clone: RAFL22-92-A12
Length = 1456
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 1064 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 1005
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 1004 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 945
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 944 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 886
>ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNTHASE 1); transferase,
transferring glycosyl groups AT4G32410 (CESA1) mRNA,
complete cds
Length = 3912
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 3468 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 3409
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 3408 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 3349
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 3348 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 3290
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 85.7 bits (43), Expect = 7e-015
Identities = 145/179 (81%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 15641070 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 15641129
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 15641130 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 15641189
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 15641190 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgactggta 15641248
>gb|AV562949.1|AV562949 AV562949 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ178g04F 3', mRNA sequence
Length = 561
Score = 77.8 bits (39), Expect = 2e-012
Identities = 141/175 (80%)
Strand = Plus / Plus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||||||||| |||| |||||||||||||| || || || |||||||
Sbjct: 387 aagggattgatcctgacccaaagcaacgagaagatggaggcgagaagaacagaccagaca 446
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 447 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 506
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgact 464
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||
Sbjct: 507 tgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccacgact 561
>emb|BX829135.1|CNS0A3FB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL74ZE06 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 666
Score = 77.8 bits (39), Expect = 2e-012
Identities = 144/179 (80%)
Strand = Plus / Minus
Query: 290 aagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccagatg 349
||||||| |||||| ||||| |||| |||||||||||||| || || || |||||||
Sbjct: 240 aagggattgatccttacccaaagcaacgagaagatggaggcgagaagaacagaccagaaa 181
Query: 350 acgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagagg 409
| ||| ||||| || || ||||| || | |||| || || || | ||| ||||||||
Sbjct: 180 atgacgatggttggtgttcggttttgtcttcccaacagacctttcaagaaagggtagaga 121
Query: 410 tggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggta 468
||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 120 tgggcaataacccataaggcgaagaagagcttaccgaaaagcggaccccacgactggta 62
>gb|AV442267.1|AV442267 AV442267 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ12d09_r 5', mRNA
sequence
Length = 433
Score = 71.9 bits (36), Expect = 1e-010
Identities = 60/68 (88%)
Strand = Plus / Minus
Query: 401 gggtagaggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccac 460
|||||||| ||| | || ||||| ||||||||||||||||| ||||| ||||| ||||||
Sbjct: 353 gggtagagatgggcaataacccataaggcgaagaagagcttcccgaaaagcggaccccac 294
Query: 461 gactggta 468
||||||||
Sbjct: 293 gactggta 286
>gb|AV546043.1|AV546043 AV546043 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL07f05F 3', mRNA sequence
Length = 358
Score = 71.9 bits (36), Expect = 1e-010
Identities = 120/148 (81%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 210 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 269
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| ||||||||||| ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 270 ccacaacaatggtgggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 329
Query: 408 ggtggacgatgacccagaaggcgaagaa 435
||| || || ||||||||||| |||||
Sbjct: 330 agtgaacaatcacccagaaggcaaagaa 357
>gb|BE038216.1|BE038216 AA10E02 AA Arabidopsis thaliana cDNA 5' similar to cellulose
synthase catalytic subunit, mRNA sequence
Length = 691
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 363 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 304
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 303 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 244
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 243 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 184
Query: 468 a 468
|
Sbjct: 183 a 183
>gb|AV823492.1|AV823492 AV823492 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-19-M03 5',
mRNA sequence
Length = 540
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 281 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 222
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 221 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 162
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 161 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 102
Query: 468 a 468
|
Sbjct: 101 a 101
>gb|AV523438.1|AV523438 AV523438 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL27f02F 3', mRNA
sequence
Length = 596
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 212 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 271
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 272 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 331
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 332 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 391
Query: 468 a 468
|
Sbjct: 392 a 392
>gb|AV523533.1|AV523533 AV523533 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL31a04F 3', mRNA
sequence
Length = 433
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 233 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 292
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 293 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 352
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 353 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 412
Query: 468 a 468
|
Sbjct: 413 a 413
>gb|AV523635.1|AV523635 AV523635 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL34f12F 3', mRNA
sequence
Length = 545
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 206 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 265
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 266 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 325
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 326 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 385
Query: 468 a 468
|
Sbjct: 386 a 386
>gb|AV530046.1|AV530046 AV530046 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL56g12R 5', mRNA
sequence
Length = 506
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 261 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 320
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 321 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 380
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 381 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 440
Query: 468 a 468
|
Sbjct: 441 a 441
>gb|AV546683.1|AV546683 AV546683 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL17h10F 3', mRNA sequence
Length = 563
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 266 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 325
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 326 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 385
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 386 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 445
Query: 468 a 468
|
Sbjct: 446 a 446
>gb|AV547198.1|AV547198 AV547198 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL27a09F 3', mRNA sequence
Length = 541
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 264 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 323
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 324 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 383
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 384 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 443
Query: 468 a 468
|
Sbjct: 444 a 444
>gb|BP582979.1|BP582979 BP582979 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-38-P11 3',
mRNA sequence
Length = 455
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 269 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 328
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 329 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 388
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 389 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 448
Query: 468 a 468
|
Sbjct: 449 a 449
>gb|BP614740.1|BP614740 BP614740 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-98-E05 3',
mRNA sequence
Length = 481
Score = 65.9 bits (33), Expect = 6e-009
Identities = 114/141 (80%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 232 tgaagggatcaatcctaacccaaaacaacgagaagatagaagccaagagaacagaccaga 291
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | |||||||||||| ||||| |
Sbjct: 292 ccacaacaatggtaggagtccggttctgtcgacccatcacccccttgaggaaagggtaca 351
Query: 408 ggtggacgatgacccagaagg 428
||| || || ||||||||||
Sbjct: 352 agtgaacaattacccagaagg 372
>gb|BP617268.1|BP617268 BP617268 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-23-E02 3',
mRNA sequence
Length = 461
Score = 65.9 bits (33), Expect = 6e-009
Identities = 138/173 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 250 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 309
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 310 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 369
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccac 460
||| || || ||||||||||| ||||| | ||| || ||||| || ||||||
Sbjct: 370 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccac 422
>gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synthase catalytic subunit (Ath-B)
mRNA, complete cds
Length = 3682
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 3403 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 3344
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 3343 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 3284
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 3283 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 3224
Query: 468 a 468
|
Sbjct: 3223 a 3223
>dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3614
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 3364 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 3305
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 3304 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 3245
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 3244 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 3185
Query: 468 a 468
|
Sbjct: 3184 a 3184
>gb|AY045960.1| Arabidopsis thaliana putative cellulose synthase catalytic subunit
(At5g05170) mRNA, partial cds
Length = 574
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 281 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 222
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 221 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 162
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 161 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 102
Query: 468 a 468
|
Sbjct: 101 a 101
>emb|AX030946.1| Sequence 9 from Patent WO9800549
Length = 3614
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 3364 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 3305
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 3304 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 3245
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 3244 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 3185
Query: 468 a 468
|
Sbjct: 3184 a 3184
>gb|BT002335.1| Arabidopsis thaliana clone C104938 putative cellulose synthase
catalytic subunit (At5g05170) mRNA, complete cds
Length = 3229
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 3148 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 3089
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 3088 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 3029
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 3028 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 2969
Query: 468 a 468
|
Sbjct: 2968 a 2968
>emb|BX833092.1|CNS0A0FM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL33ZG12 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 670
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 410 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 351
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 350 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 291
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 290 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 231
Query: 468 a 468
|
Sbjct: 230 a 230
>emb|BX833785.1|CNS0A0C4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL77ZA04 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 509
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Minus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 246 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 187
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 186 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 127
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 126 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 67
Query: 468 a 468
|
Sbjct: 66 a 66
>dbj|AB018111.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A11
Length = 29292
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 11049 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 11108
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 11109 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 11168
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 11169 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 11228
Query: 468 a 468
|
Sbjct: 11229 a 11229
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 65.9 bits (33), Expect = 6e-009
Identities = 144/181 (79%)
Strand = Plus / Plus
Query: 288 tgaagggatcgatcctgacccagagcagggagaagatggaggccagcagcacggaccaga 347
|||||||||| ||||| ||||| | || |||||||| || |||| || || |||||||
Sbjct: 1459489 tgaagggatcaatcctaacccacaacaacgagaagatagaagccaagagaacagaccaga 1459548
Query: 348 tgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtaga 407
|| |||||||| || ||||||||||| || ||||| | ||||||||||| ||||| |
Sbjct: 1459549 ccacaacaatggtaggagtccggttctgtcgacccatcaaacccttgaggaaagggtaca 1459608
Query: 408 ggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactggt 467
||| || || ||||||||||| ||||| | ||| || ||||| || ||||| || ||||
Sbjct: 1459609 agtgaacaatcacccagaaggcaaagaacaacttaccaaagagtggtccccatgattggt 1459668
Query: 468 a 468
|
Sbjct: 1459669 a 1459669
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 238 tcagcagttgatgccacact 257
||||||||||||||||||||
Sbjct: 5489834 tcagcagttgatgccacact 5489853
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 235,080
Number of Sequences: 1013581
Number of extensions: 235080
Number of successful extensions: 20438
Number of sequences better than 0.5: 122
Number of HSP's better than 0.5 without gapping: 123
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 19595
Number of HSP's gapped (non-prelim): 842
length of query: 526
length of database: 908,940,872
effective HSP length: 20
effective length of query: 506
effective length of database: 888,669,252
effective search space: 449666641512
effective search space used: 449666641512
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)