BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBB9c12.pg.2.1
(545 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB185516.1|CB185516 EST00049 Arabidopsis Salicylic Acid ... 50 4e-004
emb|BX945308.1| Arabidopsis thaliana T-DNA flanking sequenc... 46 0.006
emb|BX945309.1| Arabidopsis thaliana T-DNA flanking sequenc... 46 0.006
gb|AV439475.1|AV439475 AV439475 Arabidopsis thaliana above-... 46 0.006
gb|BP624952.1|BP624952 BP624952 RAFL17 Arabidopsis thaliana... 46 0.006
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 46 0.006
emb|AX412617.1| Sequence 381 from Patent WO0222675 46 0.006
emb|AX507722.1| Sequence 2417 from Patent WO0216655 46 0.006
emb|AX589823.1| Sequence 5 from Patent WO02081695 46 0.006
emb|AX652007.1| Sequence 899 from Patent WO03000898 46 0.006
gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 ... 46 0.006
emb|BX815728.1|CNS0AAUV Arabidopsis thaliana Full-length cD... 46 0.006
emb|BX817698.1|CNS0ACPQ Arabidopsis thaliana Full-length cD... 46 0.006
emb|CQ974284.1| Sequence 38 from Patent WO2004113540 46 0.006
emb|CQ974285.1| Sequence 39 from Patent WO2004113540 46 0.006
gb|BT022019.1| Arabidopsis thaliana At1g05680 gene, complet... 46 0.006
ref|NM_100447.2| Arabidopsis thaliana transferase, transfer... 46 0.006
ref|NM_100448.2| Arabidopsis thaliana UDP-glycosyltransfera... 46 0.006
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 46 0.006
emb|AX211608.1| Sequence 7 from Patent WO0159140 44 0.025
gb|BT008319.1| Arabidopsis thaliana At2g15490 gene, complet... 44 0.025
gb|AC006248.4| Arabidopsis thaliana chromosome 2 clone F9O1... 44 0.025
emb|CQ803908.1| Sequence 319 from Patent WO2004035798 44 0.025
emb|CQ974271.1| Sequence 25 from Patent WO2004113540 44 0.025
ref|NM_127109.3| Arabidopsis thaliana UDP-glycosyltransfera... 44 0.025
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 44 0.025
gb|AV783611.1|AV783611 AV783611 RAFL5 Arabidopsis thaliana ... 42 0.097
emb|AX211617.1| Sequence 16 from Patent WO0159140 42 0.097
gb|AY080716.1| Arabidopsis thaliana putative glucosyltransf... 42 0.097
gb|AY117336.1| Arabidopsis thaliana putative glucosyltransf... 42 0.097
gb|AY084880.1| Arabidopsis thaliana clone 120105 mRNA, comp... 42 0.097
emb|BX823179.1|CNS0A76C Arabidopsis thaliana Full-length cD... 42 0.097
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 42 0.097
emb|AL133314.1|ATF12A12 Arabidopsis thaliana DNA chromosome... 42 0.097
ref|NM_114534.3| Arabidopsis thaliana UDP-glycosyltransfera... 42 0.097
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 42 0.097
gb|CL490813.1|CL490813 SAIL_546_E11.v1 SAIL Collection Arab... 40 0.39
gb|W43072.1|W43072 22663 Lambda-PRL2 Arabidopsis thaliana c... 40 0.39
gb|CD532337.1|CD532337 26M11 Arabidopsis Leaf Senescence Li... 40 0.39
gb|BP570523.1|BP570523 BP570523 RAFL14 Arabidopsis thaliana... 40 0.39
gb|BP572287.1|BP572287 BP572287 RAFL14 Arabidopsis thaliana... 40 0.39
gb|BP581785.1|BP581785 BP581785 RAFL14 Arabidopsis thaliana... 40 0.39
gb|BP582617.1|BP582617 BP582617 RAFL14 Arabidopsis thaliana... 40 0.39
gb|BP670417.1|BP670417 BP670417 RAFL21 Arabidopsis thaliana... 40 0.39
gb|AC024228.1|AC024228 Arabidopsis thaliana chromosome I cl... 40 0.39
gb|AY062579.1| Arabidopsis thaliana UDP-glucose glucosyltra... 40 0.39
gb|AY093357.1| Arabidopsis thaliana UDP-glucose glucosyltra... 40 0.39
gb|AY056277.1| Arabidopsis thaliana putative glucosyltransf... 40 0.39
gb|AY117218.1| Arabidopsis thaliana putative glucosyltransf... 40 0.39
emb|AX506881.1| Sequence 1576 from Patent WO0216655 40 0.39
emb|AX507117.1| Sequence 1812 from Patent WO0216655 40 0.39
emb|AX651852.1| Sequence 718 from Patent WO03000898 40 0.39
gb|AY087866.1| Arabidopsis thaliana clone 39040 mRNA, compl... 40 0.39
gb|AF332418.1| Arabidopsis thaliana clone C00081 (e) putati... 40 0.39
gb|AC068562.4|T16E15 Sequence of BAC T16E15 from Arabidopsi... 40 0.39
gb|AC006533.8| Arabidopsis thaliana chromosome 2 clone F20M... 40 0.39
emb|BX822917.1|CNS0A5UH Arabidopsis thaliana Full-length cD... 40 0.39
emb|BX824689.1|CNS0A5KJ Arabidopsis thaliana Full-length cD... 40 0.39
emb|BX823058.1|CNS0A63W Arabidopsis thaliana Full-length cD... 40 0.39
emb|BX819598.1|CNS0A8WW Arabidopsis thaliana Full-length cD... 40 0.39
dbj|AB016819.1| Arabidopsis thaliana mRNA for UDP-glucose g... 40 0.39
emb|CQ805414.1| Sequence 1825 from Patent WO2004035798 40 0.39
emb|CQ974282.1| Sequence 36 from Patent WO2004113540 40 0.39
emb|CQ974309.1| Sequence 63 from Patent WO2004113540 40 0.39
emb|CQ974333.1| Sequence 87 from Patent WO2004113540 40 0.39
emb|AL161667.1|ATF1I16 Arabidopsis thaliana DNA chromosome ... 40 0.39
ref|NM_102086.2| Arabidopsis thaliana AT2; UDP-glycosyltran... 40 0.39
ref|NM_115428.2| Arabidopsis thaliana UDP-glycosyltransfera... 40 0.39
ref|NM_128737.3| Arabidopsis thaliana UDP-glycosyltransfera... 40 0.39
ref|NM_128738.2| Arabidopsis thaliana ATP binding / kinase/... 40 0.39
ref|NM_001036001.1| Arabidopsis thaliana AT2; UDP-glycosylt... 40 0.39
>gb|CB185516.1|CB185516 EST00049 Arabidopsis Salicylic Acid Subtracted Library Arabidopsis
thaliana cDNA clone SA2-B12 similar to putative
glucosyltransferase, mRNA sequence
Length = 864
Score = 50.1 bits (25), Expect = 4e-004
Identities = 55/65 (84%)
Strand = Plus / Plus
Query: 137 cagctggaagttctagcacataaagctacaggttgtttcttcacacattgcggatggaac 196
||||| || ||| ||||||||||| | | ||||||||||| ||||| || |||||||||
Sbjct: 456 cagctagaggttttagcacataaatcaatcggttgtttcttgacacactgtggatggaac 515
Query: 197 tcgac 201
|||||
Sbjct: 516 tcgac 520
>emb|BX945308.1| Arabidopsis thaliana T-DNA flanking sequence GK-714B07-025038,
genomic survey sequence
Length = 560
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 365 ggttgtttcgtgacacattgtggatggaactcgac 331
>emb|BX945309.1| Arabidopsis thaliana T-DNA flanking sequence GK-714B07-025109,
genomic survey sequence
Length = 324
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 148 ggttgtttcgtgacacattgtggatggaactcgac 114
>gb|AV439475.1|AV439475 AV439475 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APD01f02_f 3', mRNA
sequence
Length = 496
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 430 ggttgtttcgtgacacattgtggatggaactcgac 396
>gb|BP624952.1|BP624952 BP624952 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-42-B16 3',
mRNA sequence
Length = 433
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 430 ggttgtttcttgacacactgtggatggaactcgac 396
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1703404 ggttgtttcttgacacactgtggatggaactcgac 1703370
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 1701421 ggttgtttcgtgacacattgtggatggaactcgac 1701387
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 7895208 ttcttgacgcattgcgggtggaactcgacgttggaa 7895173
>emb|AX412617.1| Sequence 381 from Patent WO0222675
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1030 ggttgtttcttgacacactgtggatggaactcgac 1064
>emb|AX507722.1| Sequence 2417 from Patent WO0216655
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1030 ggttgtttcttgacacactgtggatggaactcgac 1064
>emb|AX589823.1| Sequence 5 from Patent WO02081695
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1030 ggttgtttcttgacacactgtggatggaactcgac 1064
>emb|AX652007.1| Sequence 899 from Patent WO03000898
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1030 ggttgtttcttgacacactgtggatggaactcgac 1064
>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete
sequence
Length = 103223
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 85052 ggttgtttcttgacacactgtggatggaactcgac 85018
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 83069 ggttgtttcgtgacacattgtggatggaactcgac 83035
>emb|BX815728.1|CNS0AAUV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS89ZD03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1491
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1065 ggttgtttcttgacacactgtggatggaactcgac 1099
>emb|BX817698.1|CNS0ACPQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL37ZF06 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 1319
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 928 ggttgtttcttgacacactgtggatggaactcgac 962
>emb|CQ974284.1| Sequence 38 from Patent WO2004113540
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 1030 ggttgtttcgtgacacattgtggatggaactcgac 1064
>emb|CQ974285.1| Sequence 39 from Patent WO2004113540
Length = 1362
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1030 ggttgtttcttgacacactgtggatggaactcgac 1064
>gb|BT022019.1| Arabidopsis thaliana At1g05680 gene, complete cds
Length = 1423
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1040 ggttgtttcttgacacactgtggatggaactcgac 1074
>ref|NM_100447.2| Arabidopsis thaliana transferase, transferring glycosyl groups
AT1G05670 mRNA, complete cds
Length = 3560
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 1035 ggttgtttcgtgacacattgtggatggaactcgac 1069
>ref|NM_100448.2| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
transferring glycosyl groups / transferase, transferring
hexosyl groups AT1G05680 mRNA, complete cds
Length = 1516
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1080 ggttgtttcttgacacactgtggatggaactcgac 1114
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||||| ||||| || ||||||||||||||
Sbjct: 1703527 ggttgtttcttgacacactgtggatggaactcgac 1703493
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 167 ggttgtttcttcacacattgcggatggaactcgac 201
||||||||| | |||||||| ||||||||||||||
Sbjct: 1701544 ggttgtttcgtgacacattgtggatggaactcgac 1701510
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 7895383 ttcttgacgcattgcgggtggaactcgacgttggaa 7895348
>emb|AX211608.1| Sequence 7 from Patent WO0159140
Length = 1649
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 1311 cattgcggatggaactcgactttgga 1336
>gb|BT008319.1| Arabidopsis thaliana At2g15490 gene, complete cds
Length = 1455
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 1117 cattgcggatggaactcgactttgga 1142
>gb|AC006248.4| Arabidopsis thaliana chromosome 2 clone F9O13 map mi398, complete
sequence
Length = 119753
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 11658 cattgcggatggaactcgactttgga 11683
>emb|CQ803908.1| Sequence 319 from Patent WO2004035798
Length = 1383
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 1045 cattgcggatggaactcgactttgga 1070
>emb|CQ974271.1| Sequence 25 from Patent WO2004113540
Length = 1446
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 1108 cattgcggatggaactcgactttgga 1133
>ref|NM_127109.3| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
transferring glycosyl groups AT2G15490 transcript variant
AT2G15490.1 mRNA, complete cds
Length = 1672
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 1232 cattgcggatggaactcgactttgga 1257
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgacattgga 207
|||||||||||||||||||| |||||
Sbjct: 6770142 cattgcggatggaactcgactttgga 6770167
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 13526933 ggatggaactcgacattgga 13526952
>gb|AV783611.1|AV783611 AV783611 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-11-H09 3',
mRNA sequence
Length = 532
Score = 42.1 bits (21), Expect = 0.097
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 169 ttgtttcttcacacattgcggatggaactcgac 201
||||||||| ||||| || ||||||||||||||
Sbjct: 436 ttgtttcttgacacactgtggatggaactcgac 404
>emb|AX211617.1| Sequence 16 from Patent WO0159140
Length = 1433
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1122 cattgcggatggaactcgaca 1142
>gb|AY080716.1| Arabidopsis thaliana putative glucosyltransferase (At3g46670) mRNA,
complete cds
Length = 1689
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1214 cattgcggatggaactcgaca 1234
>gb|AY117336.1| Arabidopsis thaliana putative glucosyltransferase (At3g46670) mRNA,
complete cds
Length = 1387
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1045 cattgcggatggaactcgaca 1065
>gb|AY084880.1| Arabidopsis thaliana clone 120105 mRNA, complete sequence
Length = 1596
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1134 cattgcggatggaactcgaca 1154
>emb|BX823179.1|CNS0A76C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB95ZF09 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1638
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1120 cattgcggatggaactcgaca 1140
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 17157153 cattgcggatggaactcgaca 17157133
Score = 40.1 bits (20), Expect = 0.39
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 179 acacattgcggatggaactcgaca 202
|||||||| |||||||||||||||
Sbjct: 20636397 acacattgtggatggaactcgaca 20636420
>emb|AL133314.1|ATF12A12 Arabidopsis thaliana DNA chromosome 3, BAC clone F12A12
Length = 100815
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 92208 cattgcggatggaactcgaca 92188
>ref|NM_114534.3| Arabidopsis thaliana UDP-glycosyltransferase/ transferase,
transferring glycosyl groups AT3G46670 mRNA, complete cds
Length = 1732
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 1215 cattgcggatggaactcgaca 1235
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 42.1 bits (21), Expect = 0.097
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 182 cattgcggatggaactcgaca 202
|||||||||||||||||||||
Sbjct: 17204091 cattgcggatggaactcgaca 17204071
Score = 40.1 bits (20), Expect = 0.39
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 179 acacattgcggatggaactcgaca 202
|||||||| |||||||||||||||
Sbjct: 20683922 acacattgtggatggaactcgaca 20683945
>gb|CL490813.1|CL490813 SAIL_546_E11.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_546_E11.v1, DNA sequence
Length = 906
Score = 40.1 bits (20), Expect = 0.39
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 179 acacattgcggatggaactcgaca 202
|||||||| |||||||||||||||
Sbjct: 494 acacattgtggatggaactcgaca 471
>gb|W43072.1|W43072 22663 Lambda-PRL2 Arabidopsis thaliana cDNA clone 249G4T7, mRNA
sequence
Length = 503
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 281 ttcttgacgcattgcgggtggaactcgacgttggaa 316
>gb|CD532337.1|CD532337 26M11 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 518
Score = 40.1 bits (20), Expect = 0.39
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 173 ttcttcacacattgcggatggaactcgacatt 204
||||| |||||||| ||||||||||| |||||
Sbjct: 121 ttcttaacacattgtggatggaactcaacatt 152
>gb|BP570523.1|BP570523 BP570523 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-72-O03 3',
mRNA sequence
Length = 472
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 378 ggatggaactcgacattgga 359
>gb|BP572287.1|BP572287 BP572287 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-79-G18 3',
mRNA sequence
Length = 456
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 376 ggatggaactcgacattgga 357
>gb|BP581785.1|BP581785 BP581785 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-33-F23 3',
mRNA sequence
Length = 448
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 377 ggatggaactcgacattgga 358
>gb|BP582617.1|BP582617 BP582617 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-36-P09 3',
mRNA sequence
Length = 451
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 377 ggatggaactcgacattgga 358
>gb|BP670417.1|BP670417 BP670417 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-34-P09 3',
mRNA sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 194 aactcgacattggaagcaat 213
||||||||||||||||||||
Sbjct: 428 aactcgacattggaagcaat 409
>gb|AC024228.1|AC024228 Arabidopsis thaliana chromosome I clone F8J5, *** SEQUENCING IN
PROGRESS ***, 7 unordered pieces
Length = 48282
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 36182 ttcttgacgcattgcgggtggaactcgacgttggaa 36217
>gb|AY062579.1| Arabidopsis thaliana UDP-glucose glucosyltransferase (At1g22360;
T16E15.3) mRNA, complete cds
Length = 1641
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 1184 ttcttgacgcattgcgggtggaactcgacgttggaa 1219
>gb|AY093357.1| Arabidopsis thaliana UDP-glucose glucosyltransferase (At1g22360)
mRNA, complete cds
Length = 1478
Score = 40.1 bits (20), Expect = 0.39
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 173 ttcttcacacattgcggatggaactcgacattggaa 208
||||| || |||||||| ||||||||||| ||||||
Sbjct: 1120 ttcttgacgcattgcgggtggaactcgacgttggaa 1155
>gb|AY056277.1| Arabidopsis thaliana putative glucosyltransferase (At2g31790) mRNA,
complete cds
Length = 1617
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 1121 ggatggaactcgacattgga 1140
>gb|AY117218.1| Arabidopsis thaliana putative glucosyltransferase (At2g31790) mRNA,
complete cds
Length = 1405
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 1063 ggatggaactcgacattgga 1082
>emb|AX506881.1| Sequence 1576 from Patent WO0216655
Length = 1374
Score = 40.1 bits (20), Expect = 0.39
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 188 ggatggaactcgacattgga 207
||||||||||||||||||||
Sbjct: 1063 ggatggaactcgacattgga 1082
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 304,236
Number of Sequences: 1013581
Number of extensions: 304236
Number of successful extensions: 19470
Number of sequences better than 0.5: 71
Number of HSP's better than 0.5 without gapping: 76
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18193
Number of HSP's gapped (non-prelim): 1277
length of query: 545
length of database: 908,940,872
effective HSP length: 20
effective length of query: 525
effective length of database: 888,669,252
effective search space: 466551357300
effective search space used: 466551357300
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)