BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAZ4d09.yg.2.1
(542 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CC055629.1|CC055629 SALK_095303.37.15.x Arabidopsis thal... 50 4e-004
emb|BX831593.1|CNS0A0XA Arabidopsis thaliana Full-length cD... 50 4e-004
emb|BX832761.1|CNS0A0Y9 Arabidopsis thaliana Full-length cD... 50 4e-004
dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosom... 50 4e-004
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 50 4e-004
ref|NM_120787.2| Arabidopsis thaliana unknown protein AT5G0... 50 4e-004
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 50 4e-004
>gb|CC055629.1|CC055629 SALK_095303.37.15.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_095303.37.15.x,
DNA sequence
Length = 425
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 252 atgagccactatgtccttgtcgtctaccg 280
>emb|BX831593.1|CNS0A0XA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH17ZE03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1329
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 107 atgagccactatgtccttgtcgtctaccg 135
>emb|BX832761.1|CNS0A0Y9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH9ZB10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1348
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 122 atgagccactatgtccttgtcgtctaccg 150
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
Length = 86380
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 72263 atgagccactatgtccttgtcgtctaccg 72235
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 2022325 atgagccactatgtccttgtcgtctaccg 2022297
>ref|NM_120787.2| Arabidopsis thaliana unknown protein AT5G07050 mRNA, complete cds
Length = 1349
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 122 atgagccactatgtccttgtcgtctaccg 150
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 151 atgagccactatgtccttgttgtctaccg 179
|||||||||||||||||||| ||||||||
Sbjct: 2193288 atgagccactatgtccttgtcgtctaccg 2193260
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 201,670
Number of Sequences: 1013581
Number of extensions: 201670
Number of successful extensions: 14552
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14386
Number of HSP's gapped (non-prelim): 166
length of query: 542
length of database: 908,940,872
effective HSP length: 20
effective length of query: 522
effective length of database: 888,669,252
effective search space: 463885349544
effective search space used: 463885349544
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)