BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAW3a11.yg.2.1
(969 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY039515.1| Arabidopsis thaliana AT3g61130/T20K12_30 mRN... 103 6e-020
gb|BT000630.1| Arabidopsis thaliana unknown protein (At3g6... 103 6e-020
emb|BX824243.1|CNS0A7GQ Arabidopsis thaliana Full-length cD... 103 6e-020
ref|NM_115977.2| Arabidopsis thaliana transferase, transfer... 103 6e-020
emb|AJ243015.1|ATH243015 Arabidopsis thaliana LGT1 gene, an... 94 5e-017
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 94 5e-017
emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome... 94 5e-017
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 94 5e-017
gb|CD529386.1|CD529386 02L11 Arabidopsis Leaf Senescence Li... 80 8e-013
gb|AV548282.1|AV548282 AV548282 Arabidopsis thaliana roots ... 80 8e-013
gb|AV563687.1|AV563687 AV563687 Arabidopsis thaliana green ... 80 8e-013
gb|AV565232.1|AV565232 AV565232 Arabidopsis thaliana green ... 80 8e-013
gb|AV565879.1|AV565879 AV565879 Arabidopsis thaliana green ... 80 8e-013
gb|BP598303.1|BP598303 BP598303 RAFL16 Arabidopsis thaliana... 80 8e-013
gb|BP605408.1|BP605408 BP605408 RAFL16 Arabidopsis thaliana... 80 8e-013
gb|AV810311.1|AV810311 AV810311 RAFL9 Arabidopsis thaliana ... 72 2e-010
gb|BP646369.1|BP646369 BP646369 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|AV522297.1|AV522297 AV522297 Arabidopsis thaliana aboveg... 60 8e-007
gb|BP617942.1|BP617942 BP617942 RAFL16 Arabidopsis thaliana... 58 3e-006
emb|BX895788.1| Arabidopsis thaliana T-DNA flanking sequenc... 54 5e-005
gb|AC006418.4| Arabidopsis thaliana chromosome 2 clone F13A... 54 5e-005
gb|AC006526.8| Arabidopsis thaliana chromosome 2 clone F11C... 54 5e-005
ref|NM_130212.2| Arabidopsis thaliana transferase, transfer... 54 5e-005
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 54 5e-005
gb|AV559515.1|AV559515 AV559515 Arabidopsis thaliana green ... 48 0.003
gb|BP665553.1|BP665553 BP665553 RAFL21 Arabidopsis thaliana... 46 0.011
gb|AC005310.3| Arabidopsis thaliana chromosome 2 clone F19D... 46 0.011
dbj|AK117704.1| Arabidopsis thaliana mRNA for unknown prote... 46 0.011
gb|AV783162.1|AV783162 AV783162 RAFL5 Arabidopsis thaliana ... 44 0.045
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 44 0.045
gb|AV561436.1|AV561436 AV561436 Arabidopsis thaliana green ... 44 0.045
gb|AY035019.1| Arabidopsis thaliana unknown protein (At2g20... 44 0.045
gb|AY059085.1| Arabidopsis thaliana unknown protein (At2g20... 44 0.045
gb|AC006234.4| Arabidopsis thaliana chromosome 2 clone F5H1... 44 0.045
dbj|AK176863.1| Arabidopsis thaliana mRNA, complete cds, cl... 44 0.045
ref|NM_127647.2| Arabidopsis thaliana transferase, transfer... 44 0.045
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.18
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 42 0.18
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 42 0.18
gb|CD533901.1|CD533901 34F4 Arabidopsis Leaf Senescence Lib... 42 0.18
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 42 0.18
gb|AC008261.5|ATAC008261 Arabidopsis thaliana chromosome II... 42 0.18
gb|AY839934.1| Arabidopsis thaliana glycosyl transferase fa... 42 0.18
ref|NM_110969.2| Arabidopsis thaliana transferase, transfer... 42 0.18
>gb|AY039515.1| Arabidopsis thaliana AT3g61130/T20K12_30 mRNA, complete cds
Length = 2542
Score = 103 bits (52), Expect = 6e-020
Identities = 127/152 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 1922 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 1981
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 1982 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 2041
Query: 277 gggatctaccacaaatggcaaaatatgaatga 308
|| || |||||||| |||||||| ||||||||
Sbjct: 2042 ggtatataccacaagtggcaaaacatgaatga 2073
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 2209 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 2268
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 2269 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 2312
>gb|BT000630.1| Arabidopsis thaliana unknown protein (At3g61130/T20K12_30) mRNA,
complete cds
Length = 1920
Score = 103 bits (52), Expect = 6e-020
Identities = 127/152 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 1600 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 1659
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 1660 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 1719
Query: 277 gggatctaccacaaatggcaaaatatgaatga 308
|| || |||||||| |||||||| ||||||||
Sbjct: 1720 ggtatataccacaagtggcaaaacatgaatga 1751
>emb|BX824243.1|CNS0A7GQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH32ZE03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 2452
Score = 103 bits (52), Expect = 6e-020
Identities = 127/152 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 1873 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 1932
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 1933 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 1992
Query: 277 gggatctaccacaaatggcaaaatatgaatga 308
|| || |||||||| |||||||| ||||||||
Sbjct: 1993 ggtatataccacaagtggcaaaacatgaatga 2024
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 2161 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 2220
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 2221 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 2264
>ref|NM_115977.2| Arabidopsis thaliana transferase, transferring glycosyl groups
AT3G61130 mRNA, complete cds
Length = 2546
Score = 103 bits (52), Expect = 6e-020
Identities = 127/152 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 1922 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 1981
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 1982 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 2041
Query: 277 gggatctaccacaaatggcaaaatatgaatga 308
|| || |||||||| |||||||| ||||||||
Sbjct: 2042 ggtatataccacaagtggcaaaacatgaatga 2073
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 2210 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 2269
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 2270 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 2313
>emb|AJ243015.1|ATH243015 Arabidopsis thaliana LGT1 gene, and partial FUSCA6 gene
Length = 5000
Score = 93.7 bits (47), Expect = 5e-017
Identities = 119/143 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 3228 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 3287
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 3288 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 3347
Query: 277 gggatctaccacaaatggcaaaa 299
|| || |||||||| ||||||||
Sbjct: 3348 ggtatataccacaagtggcaaaa 3370
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 3610 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 3669
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 3670 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 3713
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 93.7 bits (47), Expect = 5e-017
Identities = 119/143 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 22583272 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 22583331
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 22583332 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 22583391
Query: 277 gggatctaccacaaatggcaaaa 299
|| || |||||||| ||||||||
Sbjct: 22583392 ggtatataccacaagtggcaaaa 22583414
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 22583654 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 22583713
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 22583714 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 22583757
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 89080 tgggcttatggaatgaatatctttgatct 89052
>emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome 3, BAC clone T20K12
Length = 109155
Score = 93.7 bits (47), Expect = 5e-017
Identities = 119/143 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 13133 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 13192
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 13193 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 13252
Query: 277 gggatctaccacaaatggcaaaa 299
|| || |||||||| ||||||||
Sbjct: 13253 ggtatataccacaagtggcaaaa 13275
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 13515 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 13574
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 13575 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 13618
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 93.7 bits (47), Expect = 5e-017
Identities = 119/143 (83%)
Strand = Plus / Plus
Query: 157 gacaaatatcttaatttttcaaatccacacattgctcggaactttgatccaaatgcatgt 216
||||| ||||| || ||||| ||||| |||||||| ||||||| |||||||||| |||
Sbjct: 22635973 gacaagtatctcaacttttcgaatcctcacattgcgaggaacttcaatccaaatgcttgt 22636032
Query: 217 ggctgggcttatgggatgaacatctttgatctgagggagtggaagaagaaagatattact 276
|| ||||||||||| |||||||| || || || | ||| |||||||||| ||| || |||
Sbjct: 22636033 ggatgggcttatggaatgaacatgttcgacctaaaggaatggaagaagagagacatcact 22636092
Query: 277 gggatctaccacaaatggcaaaa 299
|| || |||||||| ||||||||
Sbjct: 22636093 ggtatataccacaagtggcaaaa 22636115
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Plus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 22636355 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 22636414
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 22636415 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 22636458
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 11528 tgggcttatggaatgaatatctttgatct 11556
>gb|CD529386.1|CD529386 02L11 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 360
Score = 79.8 bits (40), Expect = 8e-013
Identities = 72/83 (86%)
Strand = Plus / Minus
Query: 466 aatgggaacatgaagccatggctggagctagcaatgaccaagtaccgaccatattggacc 525
|||||||||||||| |||||| ||||| | |||||| ||||||| || || |||||||||
Sbjct: 332 aatgggaacatgaaaccatggttggagttggcaatgtccaagtatcggccgtattggacc 273
Query: 526 aagtatatcaagtatgatcaccc 548
||||| ||||||| ||||||||
Sbjct: 272 aagtacatcaagttngatcaccc 250
>gb|AV548282.1|AV548282 AV548282 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZL50h12F 3', mRNA sequence
Length = 546
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 332 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 273
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 272 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 229
>gb|AV563687.1|AV563687 AV563687 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ191e10F 3', mRNA sequence
Length = 560
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 352 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 293
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 292 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 249
>gb|AV565232.1|AV565232 AV565232 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ219h12F 3', mRNA sequence
Length = 341
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 334 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 275
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 274 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 231
>gb|AV565879.1|AV565879 AV565879 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ232d06F 3', mRNA sequence
Length = 434
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 285 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 226
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 225 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 182
>gb|BP598303.1|BP598303 BP598303 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-02-O18 3',
mRNA sequence
Length = 414
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 332 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 273
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 272 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 229
>gb|BP605408.1|BP605408 BP605408 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-66-L11 3',
mRNA sequence
Length = 423
Score = 79.8 bits (40), Expect = 8e-013
Identities = 88/104 (84%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 332 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 273
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || |||||||||||||| ||||||| |||||||||
Sbjct: 272 aaatatcggccgtattggaccaagtacatcaagtttgatcaccc 229
>gb|AV810311.1|AV810311 AV810311 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-63-G13 3',
mRNA sequence
Length = 433
Score = 71.9 bits (36), Expect = 2e-010
Identities = 87/104 (83%)
Strand = Plus / Minus
Query: 445 aatgctgctgtggttcattacaatgggaacatgaagccatggctggagctagcaatgacc 504
||||| || |||||||| || || ||||||||||| |||||| ||||| | |||||| ||
Sbjct: 332 aatgcagcagtggttcactataacgggaacatgaaaccatggttggagttggcaatgtcc 273
Query: 505 aagtaccgaccatattggaccaagtatatcaagtatgatcaccc 548
|| || || || ||||||||||| || ||||||| |||||||||
Sbjct: 272 aaatatcggccgtattggaccaaatacatcaagtttgatcaccc 229
>gb|BP646369.1|BP646369 BP646369 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-71-O08 3',
mRNA sequence
Length = 405
Score = 61.9 bits (31), Expect = 2e-007
Identities = 80/95 (84%), Gaps = 1/95 (1%)
Strand = Plus / Minus
Query: 454 gtggttcattacaatgggaacatgaagccatggctggagctagcaatgaccaagtaccga 513
|||||||| || || ||||||||||| |||||| ||||| | |||||| |||| || ||
Sbjct: 324 gtggttcactataacgggaacatgaaaccatggttggagttggcaatgtccaaatatcgg 265
Query: 514 ccatattggaccaagtatatcaagtatgatcaccc 548
|| |||| ||||||||| ||||||| |||||||||
Sbjct: 264 ccgtatt-gaccaagtacatcaagtttgatcaccc 231
>gb|AV522297.1|AV522297 AV522297 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ76e07F 3', mRNA
sequence
Length = 307
Score = 60.0 bits (30), Expect = 8e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 475 atgaagccatggctggagctagcaatgaccaagtaccgaccatattggaccaagtatatc 534
||||| |||||| ||||| | |||||| |||| || || || |||||||||||||| |||
Sbjct: 307 atgaaaccatggttggagttggcaatgtccaaatatcggccgtattggaccaagtacatc 248
Query: 535 aagtatgatcaccc 548
|||| |||||||||
Sbjct: 247 aagtttgatcaccc 234
>gb|BP617942.1|BP617942 BP617942 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-26-D04 3',
mRNA sequence
Length = 421
Score = 58.0 bits (29), Expect = 3e-006
Identities = 59/69 (85%)
Strand = Plus / Minus
Query: 469 gggaacatgaagccatggctggagctagcaatgaccaagtaccgaccatattggaccaag 528
||||||||||| |||||| ||||| | |||||| |||| || || || ||||||||||||
Sbjct: 405 gggaacatgaaaccatggttggagttggcaatgtccaaatatcggccgtattggaccaag 346
Query: 529 tatatcaag 537
|| ||||||
Sbjct: 345 tacatcaag 337
>emb|BX895788.1| Arabidopsis thaliana T-DNA flanking sequence GK-748A06-023447,
genomic survey sequence
Length = 375
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatctgagggagtggaagaagaa 266
||||||||||||||||||||||| || |||| || |||||||||||
Sbjct: 120 tgggcttatgggatgaacatcttcgacctgaaagaatggaagaagaa 74
>gb|AC006418.4| Arabidopsis thaliana chromosome 2 clone F13A10 map CIC06C03, complete
sequence
Length = 84825
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatctgagggagtggaagaagaa 266
||||||||||||||||||||||| || |||| || |||||||||||
Sbjct: 1492 tgggcttatgggatgaacatcttcgacctgaaagaatggaagaagaa 1446
>gb|AC006526.8| Arabidopsis thaliana chromosome 2 clone F11C10 map CIC02E07, complete
sequence
Length = 95214
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatctgagggagtggaagaagaa 266
||||||||||||||||||||||| || |||| || |||||||||||
Sbjct: 60555 tgggcttatgggatgaacatcttcgacctgaaagaatggaagaagaa 60509
>ref|NM_130212.2| Arabidopsis thaliana transferase, transferring glycosyl groups
AT2G46480 mRNA, complete cds
Length = 1587
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 220 tgggcttatgggatgaacatctttgatctgagggagtggaagaagaa 266
||||||||||||||||||||||| || |||| || |||||||||||
Sbjct: 1228 tgggcttatgggatgaacatcttcgacctgaaagaatggaagaagaa 1274
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatctgagggagtggaagaagaa 266
||||||||||||||||||||||| || |||| || |||||||||||
Sbjct: 19083922 tgggcttatgggatgaacatcttcgacctgaaagaatggaagaagaa 19083876
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 196 aactttgatccaaatgcatgtggctgggcttatgggatgaacatctt 242
|||||||||||||| || || || |||||||| |||||| |||||||
Sbjct: 19210014 aactttgatccaaaagcctgcggatgggcttacgggatggacatctt 19210060
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 8966315 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 8966364
>gb|AV559515.1|AV559515 AV559515 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ118g12F 3', mRNA sequence
Length = 263
Score = 48.1 bits (24), Expect = 0.003
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 517 tattggaccaagtatatcaagtatgatcaccc 548
|||||||||||||| ||||||| |||||||||
Sbjct: 255 tattggaccaagtacatcaagtttgatcaccc 224
>gb|BP665553.1|BP665553 BP665553 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-16-M01 3',
mRNA sequence
Length = 423
Score = 46.1 bits (23), Expect = 0.011
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 458 ttcattacaatgggaacatgaagccatggct 488
|||||||||||||||||||||| || |||||
Sbjct: 386 ttcattacaatgggaacatgaaaccgtggct 356
>gb|AC005310.3| Arabidopsis thaliana chromosome 2 clone F19D11 map CIC06C03, complete
sequence
Length = 68415
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 196 aactttgatccaaatgcatgtggctgggcttatgggatgaacatctt 242
|||||||||||||| || || || |||||||| |||||| |||||||
Sbjct: 2153 aactttgatccaaaagcctgcggatgggcttacgggatggacatctt 2199
>dbj|AK117704.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone:
RAFL17-37-I17
Length = 1896
Score = 46.1 bits (23), Expect = 0.011
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 196 aactttgatccaaatgcatgtggctgggcttatgggatgaacatctt 242
|||||||||||||| || || || |||||||| |||||| |||||||
Sbjct: 1699 aactttgatccaaaagcctgcggatgggcttacgggatggacatctt 1745
>gb|AV783162.1|AV783162 AV783162 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-07-B15 3',
mRNA sequence
Length = 689
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 526 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 477
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EB10, mRNA sequence
Length = 406
Score = 44.1 bits (22), Expect = 0.045
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 948 gagtacctgcccgggcggccgc 969
||||||||||||||||||||||
Sbjct: 380 gagtacctgcccgggcggccgc 401
>gb|AV561436.1|AV561436 AV561436 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ151e06F 3', mRNA sequence
Length = 560
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 547 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 498
>gb|AY035019.1| Arabidopsis thaliana unknown protein (At2g20810) mRNA, complete cds
Length = 1909
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 1369 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 1418
>gb|AY059085.1| Arabidopsis thaliana unknown protein (At2g20810) mRNA, complete cds
Length = 1642
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 1235 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 1284
>gb|AC006234.4| Arabidopsis thaliana chromosome 2 clone F5H14 map mi148, complete
sequence
Length = 129667
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 72464 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 72415
>dbj|AK176863.1| Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-42-C07
Length = 1945
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 1391 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 1440
>ref|NM_127647.2| Arabidopsis thaliana transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups AT2G20810 mRNA,
complete cds
Length = 1915
Score = 44.1 bits (22), Expect = 0.045
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 197 actttgatccaaatgcatgtggctgggcttatgggatgaacatctttgat 246
||||||||||| |||| ||||| ||||| | ||| |||||| ||||||||
Sbjct: 1369 actttgatccagatgcgtgtgggtgggcgtttggaatgaacgtctttgat 1418
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
genomic survey sequence
Length = 378
Score = 42.1 bits (21), Expect = 0.18
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 949 agtacctgcccgggcggccgc 969
|||||||||||||||||||||
Sbjct: 52 agtacctgcccgggcggccgc 32
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
sequence
Length = 358
Score = 42.1 bits (21), Expect = 0.18
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 949 agtacctgcccgggcggccgc 969
|||||||||||||||||||||
Sbjct: 328 agtacctgcccgggcggccgc 348
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH04 similar to PsbA gene in chloroplast
genome, mRNA sequence
Length = 360
Score = 42.1 bits (21), Expect = 0.18
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 949 agtacctgcccgggcggccgc 969
|||||||||||||||||||||
Sbjct: 331 agtacctgcccgggcggccgc 351
>gb|CD533901.1|CD533901 34F4 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 475
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 110 tgggcttatggaatgaatatctttgatct 138
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.18
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 949 agtacctgcccgggcggccgc 969
|||||||||||||||||||||
Sbjct: 122 agtacctgcccgggcggccgc 142
>gb|AC008261.5|ATAC008261 Arabidopsis thaliana chromosome III BAC T4P13 genomic sequence,
complete sequence
Length = 93735
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 85644 tgggcttatggaatgaatatctttgatct 85616
>gb|AY839934.1| Arabidopsis thaliana glycosyl transferase family 8 protein-like gene,
complete sequence
Length = 3540
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 2588 tgggcttatggaatgaatatctttgatct 2616
>ref|NM_110969.2| Arabidopsis thaliana transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups AT3G01040 mRNA,
complete cds
Length = 2480
Score = 42.1 bits (21), Expect = 0.18
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 220 tgggcttatgggatgaacatctttgatct 248
||||||||||| ||||| |||||||||||
Sbjct: 1672 tgggcttatggaatgaatatctttgatct 1700
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 506,144
Number of Sequences: 1013581
Number of extensions: 506144
Number of successful extensions: 42387
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41054
Number of HSP's gapped (non-prelim): 1333
length of query: 969
length of database: 908,940,872
effective HSP length: 20
effective length of query: 949
effective length of database: 888,669,252
effective search space: 843347120148
effective search space used: 843347120148
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)