BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAR2a06.yg.3.1
(612 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|N96422.1|N96422 21001 CD4-14 Arabidopsis thaliana cDNA c... 36 6.8
gb|AU228751.1|AU228751 AU228751 RAFL16 Arabidopsis thaliana... 36 6.8
gb|BX837879.1|BX837879 BX837879 Arabidopsis thaliana Hormon... 36 6.8
gb|AY093140.1| Arabidopsis thaliana unknown protein (At1g51... 36 6.8
gb|BT008416.1| Arabidopsis thaliana At1g51350 gene, complet... 36 6.8
gb|AC006085.1| Arabidopsis thaliana chromosome I BAC F11M15... 36 6.8
gb|AC006587.5| Arabidopsis thaliana chromosome 2 clone T17D... 36 6.8
emb|BX841794.1|CNS09Y62 Arabidopsis thaliana Full-length cD... 36 6.8
dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosom... 36 6.8
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 36 6.8
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 36 6.8
emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome ... 36 6.8
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 36 6.8
ref|NM_104013.2| Arabidopsis thaliana unknown protein AT1G5... 36 6.8
ref|NM_115200.3| Arabidopsis thaliana unknown protein AT3G5... 36 6.8
ref|NM_126059.2| Arabidopsis thaliana zinc ion binding AT5G... 36 6.8
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 36 6.8
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 36 6.8
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 36 6.8
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 36 6.8
>gb|N96422.1|N96422 21001 CD4-14 Arabidopsis thaliana cDNA clone F1F12T7, mRNA sequence
Length = 508
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 348 gtgttttctatggatctt 365
||||||||||||||||||
Sbjct: 23 gtgttttctatggatctt 40
>gb|AU228751.1|AU228751 AU228751 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-46-M02 3',
mRNA sequence
Length = 413
Score = 36.2 bits (18), Expect = 6.8
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 244 gttctgcagctccatcatcagc 265
||||||||||| ||||||||||
Sbjct: 347 gttctgcagctgcatcatcagc 326
>gb|BX837879.1|BX837879 BX837879 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH43ZD04 5PRIM,
mRNA sequence
Length = 1023
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 890 tctggagatgatgctgcc 907
>gb|AY093140.1| Arabidopsis thaliana unknown protein (At1g51350) mRNA, complete cds
Length = 2441
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 973 tctggagatgatgctgcc 990
>gb|BT008416.1| Arabidopsis thaliana At1g51350 gene, complete cds
Length = 2001
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 877 tctggagatgatgctgcc 894
>gb|AC006085.1| Arabidopsis thaliana chromosome I BAC F11M15 genomic sequence, complete
sequence
Length = 105807
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 89629 tctggagatgatgctgcc 89646
>gb|AC006587.5| Arabidopsis thaliana chromosome 2 clone T17D12 map mi54, complete
sequence
Length = 86579
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 541 tgcatgaaatttgctcta 558
||||||||||||||||||
Sbjct: 51158 tgcatgaaatttgctcta 51141
>emb|BX841794.1|CNS09Y62 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB76ZF06 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1086
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 902 tctggagatgatgctgcc 919
>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13
Length = 83511
Score = 36.2 bits (18), Expect = 6.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 244 gttctgcagctccatcatcagc 265
||||||||||| ||||||||||
Sbjct: 76427 gttctgcagctgcatcatcagc 76448
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 36.2 bits (18), Expect = 6.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 244 gttctgcagctccatcatcagc 265
||||||||||| ||||||||||
Sbjct: 23495584 gttctgcagctgcatcatcagc 23495605
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 348 gtgttttctatggatctt 365
||||||||||||||||||
Sbjct: 19762493 gtgttttctatggatctt 19762510
>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
Length = 144628
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 348 gtgttttctatggatctt 365
||||||||||||||||||
Sbjct: 39712 gtgttttctatggatctt 39729
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 3396301 tctggagatgatgctgcc 3396318
>ref|NM_104013.2| Arabidopsis thaliana unknown protein AT1G51350 mRNA, complete cds
Length = 2441
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 973 tctggagatgatgctgcc 990
>ref|NM_115200.3| Arabidopsis thaliana unknown protein AT3G53400 mRNA, complete cds
Length = 1986
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 348 gtgttttctatggatctt 365
||||||||||||||||||
Sbjct: 892 gtgttttctatggatctt 909
>ref|NM_126059.2| Arabidopsis thaliana zinc ion binding AT5G66610 mRNA, complete cds
Length = 1690
Score = 36.2 bits (18), Expect = 6.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 244 gttctgcagctccatcatcagc 265
||||||||||| ||||||||||
Sbjct: 1346 gttctgcagctgcatcatcagc 1367
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 541 tgcatgaaatttgctcta 558
||||||||||||||||||
Sbjct: 12223381 tgcatgaaatttgctcta 12223364
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 348 gtgttttctatggatctt 365
||||||||||||||||||
Sbjct: 19810020 gtgttttctatggatctt 19810037
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 36.2 bits (18), Expect = 6.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 244 gttctgcagctccatcatcagc 265
||||||||||| ||||||||||
Sbjct: 26604737 gttctgcagctgcatcatcagc 26604758
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 36.2 bits (18), Expect = 6.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 63 tctggagatgatgctgcc 80
||||||||||||||||||
Sbjct: 19040706 tctggagatgatgctgcc 19040723
Database: At_nucl_with_EST.fasta
Posted date: May 2, 2006 2:53 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 232,032
Number of Sequences: 1013581
Number of extensions: 232032
Number of successful extensions: 15437
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14892
Number of HSP's gapped (non-prelim): 545
length of query: 612
length of database: 908,940,872
effective HSP length: 20
effective length of query: 592
effective length of database: 888,669,252
effective search space: 526092197184
effective search space used: 526092197184
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)