BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAR1e04.yg.2.1
(405 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AQ965369.1|AQ965369 LERIB75TF LERG Arabidopsis thaliana ... 54 2e-005
gb|AQ965370.1|AQ965370 LERIB75TR LERG Arabidopsis thaliana ... 54 2e-005
gb|AQ965371.1|AQ965371 LERIB75TRB LERG Arabidopsis thaliana... 54 2e-005
gb|AF506030.1| Arabidopsis thaliana laccase (lac1) mRNA, co... 54 2e-005
gb|AC007020.5| Arabidopsis thaliana chromosome 2 clone T3G2... 54 2e-005
ref|NM_129597.2| Arabidopsis thaliana copper ion binding AT... 54 2e-005
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 54 2e-005
>gb|AQ965369.1|AQ965369 LERIB75TF LERG Arabidopsis thaliana genomic clone LERIB75, DNA
sequence
Length = 264
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 6 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 65
Query: 61 ttc 63
|||
Sbjct: 66 ttc 68
>gb|AQ965370.1|AQ965370 LERIB75TR LERG Arabidopsis thaliana genomic clone LERIB75, DNA
sequence
Length = 576
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Minus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 498 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 439
Query: 61 ttc 63
|||
Sbjct: 438 ttc 436
>gb|AQ965371.1|AQ965371 LERIB75TRB LERG Arabidopsis thaliana genomic clone LERIB75, DNA
sequence
Length = 562
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Minus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 496 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 437
Query: 61 ttc 63
|||
Sbjct: 436 ttc 434
>gb|AF506030.1| Arabidopsis thaliana laccase (lac1) mRNA, complete cds
Length = 1782
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 1451 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 1510
Query: 61 ttc 63
|||
Sbjct: 1511 ttc 1513
>gb|AC007020.5| Arabidopsis thaliana chromosome 2 clone T3G21 map g4514, complete
sequence
Length = 82652
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Minus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 48666 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 48607
Query: 61 ttc 63
|||
Sbjct: 48606 ttc 48604
>ref|NM_129597.2| Arabidopsis thaliana copper ion binding AT2G40370 mRNA, complete cds
Length = 1778
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 1451 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 1510
Query: 61 ttc 63
|||
Sbjct: 1511 ttc 1513
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 54.0 bits (27), Expect = 2e-005
Identities = 54/63 (85%)
Strand = Plus / Minus
Query: 1 aaccaccccatccacctccacggctacgacttctacatcctcgccgagggcttcggcaac 60
||||| ||||| || || ||||||||||| |||||||| |||||||||| ||||| |||
Sbjct: 16865756 aaccatcccattcatctacacggctacgatttctacattatcgccgagggtttcggtaac 16865697
Query: 61 ttc 63
|||
Sbjct: 16865696 ttc 16865694
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,517
Number of Sequences: 1013581
Number of extensions: 70517
Number of successful extensions: 4779
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 4757
Number of HSP's gapped (non-prelim): 22
length of query: 405
length of database: 908,940,872
effective HSP length: 20
effective length of query: 385
effective length of database: 888,669,252
effective search space: 342137662020
effective search space used: 342137662020
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)