BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN11a10.yg.3.1
(1341 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BP826321.1|BP826321 BP826321 RAFL19 Arabidopsis thaliana... 50 0.001
gb|AY090238.1| Arabidopsis thaliana AT5g08370/F8L15_100 mRN... 46 0.016
gb|BT000619.1| Arabidopsis thaliana alpha-galactosidase - l... 46 0.016
gb|AY085529.1| Arabidopsis thaliana clone 156141 mRNA, comp... 46 0.016
emb|BX831545.1|CNS0A14Y Arabidopsis thaliana Full-length cD... 46 0.016
ref|NM_120921.3| Arabidopsis thaliana alpha-galactosidase/ ... 46 0.016
ref|NM_001036778.1| Arabidopsis thaliana alpha-galactosidas... 46 0.016
gb|AV828600.1|AV828600 AV828600 RAFL9 Arabidopsis thaliana ... 42 0.25
gb|BP836202.1|BP836202 BP836202 RAFL19 Arabidopsis thaliana... 42 0.25
gb|AY093200.1| Arabidopsis thaliana alpha-galactosidase-lik... 42 0.25
gb|BT008497.1| Arabidopsis thaliana At5g08380 gene, complet... 42 0.25
emb|BX831749.1|CNS0A16Y Arabidopsis thaliana Full-length cD... 42 0.25
emb|BX832652.1|CNS0A0ZT Arabidopsis thaliana Full-length cD... 42 0.25
ref|NM_120922.3| Arabidopsis thaliana alpha-galactosidase/ ... 42 0.25
>gb|BP826321.1|BP826321 BP826321 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-71-J21 5',
mRNA sequence
Length = 347
Score = 50.1 bits (25), Expect = 0.001
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
|||||||||||| | ||||| ||||| ||||||||||||||
Sbjct: 284 aagctgggctacaactatgttaacatcgatgattgctgggc 324
>gb|AY090238.1| Arabidopsis thaliana AT5g08370/F8L15_100 mRNA, complete cds
Length = 1373
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 737 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 779
>gb|BT000619.1| Arabidopsis thaliana alpha-galactosidase - like protein
(At5g08370/F8L15_100) mRNA, complete cds
Length = 1191
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 726 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 768
>gb|AY085529.1| Arabidopsis thaliana clone 156141 mRNA, complete sequence
Length = 1439
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 786 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 828
>emb|BX831545.1|CNS0A14Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH14ZA10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1437
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 822 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 864
>ref|NM_120921.3| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
O-glycosyl compounds AT5G08370 transcript variant
AT5G08370.1 mRNA, complete cds
Length = 1845
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 823 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 865
>ref|NM_001036778.1| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
O-glycosyl compounds AT5G08370 transcript variant
AT5G08370.2 mRNA, complete cds
Length = 1779
Score = 46.1 bits (23), Expect = 0.016
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 595 gtggaacgatcctgacatgcttgaggtgggcaacggcggcatg 637
|||||||||||| ||||||||||| ||||| || || ||||||
Sbjct: 757 gtggaacgatccagacatgcttgaagtgggaaatggaggcatg 799
>gb|AV828600.1|AV828600 AV828600 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-30-H14 5',
mRNA sequence
Length = 456
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 331 aagcttggctacaactatgttaacatcgatgattgctgggc 371
>gb|BP836202.1|BP836202 BP836202 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-15-L12 5',
mRNA sequence
Length = 389
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
|||||||||||| | ||||| ||||| |||||| |||||||
Sbjct: 283 aagctgggctacaactatgttaacatcgatgatggctgggc 323
>gb|AY093200.1| Arabidopsis thaliana alpha-galactosidase-like protein (At5g08380)
mRNA, complete cds
Length = 1414
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 330 aagcttggctacaactatgttaacatcgatgattgctgggc 370
>gb|BT008497.1| Arabidopsis thaliana At5g08380 gene, complete cds
Length = 1233
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 259 aagcttggctacaactatgttaacatcgatgattgctgggc 299
>emb|BX831749.1|CNS0A16Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH27ZG07 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1350
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 303 aagcttggctacaactatgttaacatcgatgattgctgggc 343
>emb|BX832652.1|CNS0A0ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH86ZG03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1416
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 331 aagcttggctacaactatgttaacatcgatgattgctgggc 371
>ref|NM_120922.3| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
O-glycosyl compounds AT5G08380 mRNA, complete cds
Length = 1478
Score = 42.1 bits (21), Expect = 0.25
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 86 aagctgggctacgagtatgtcaacatagatgattgctgggc 126
||||| |||||| | ||||| ||||| ||||||||||||||
Sbjct: 330 aagcttggctacaactatgttaacatcgatgattgctgggc 370
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 439,572
Number of Sequences: 1013581
Number of extensions: 439572
Number of successful extensions: 27258
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27212
Number of HSP's gapped (non-prelim): 46
length of query: 1341
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1321
effective length of database: 888,669,252
effective search space: 1173932081892
effective search space used: 1173932081892
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)