BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF31c07.yg.2.1
(352 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BP654309.1|BP654309 BP654309 RAFL19 Arabidopsis thaliana... 36 3.8
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 36 3.8
emb|AX461532.1| Sequence 461 from Patent WO0198480 36 3.8
gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis tha... 36 3.8
gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BA... 36 3.8
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 36 3.8
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 36 3.8
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 36 3.8
>gb|BP654309.1|BP654309 BP654309 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-17-C16 3',
mRNA sequence
Length = 340
Score = 36.2 bits (18), Expect = 3.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 80 ttcacatttctttctatt 97
||||||||||||||||||
Sbjct: 287 ttcacatttctttctatt 270
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 68 tgtcattggtgtttcacatttc 89
|||||||||||||| |||||||
Sbjct: 2828581 tgtcattggtgttttacatttc 2828602
>emb|AX461532.1| Sequence 461 from Patent WO0198480
Length = 1453
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 68 tgtcattggtgtttcacatttc 89
|||||||||||||| |||||||
Sbjct: 1129 tgtcattggtgttttacatttc 1150
>gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana BAC F22O13 from chromosome I,
complete sequence
Length = 133843
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 68 tgtcattggtgtttcacatttc 89
|||||||||||||| |||||||
Sbjct: 126655 tgtcattggtgttttacatttc 126676
>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence,
complete sequence
Length = 90721
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 149 tcagccgcatttggaatgagac 170
||||||| ||||||||||||||
Sbjct: 8561 tcagccggatttggaatgagac 8582
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 149 tcagccgcatttggaatgagac 170
||||||| ||||||||||||||
Sbjct: 2593619 tcagccggatttggaatgagac 2593640
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 149 tcagccgcatttggaatgagac 170
||||||| ||||||||||||||
Sbjct: 2597644 tcagccggatttggaatgagac 2597665
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 36.2 bits (18), Expect = 3.8
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 68 tgtcattggtgtttcacatttc 89
|||||||||||||| |||||||
Sbjct: 2828732 tgtcattggtgttttacatttc 2828753
Database: At_nucl_with_EST.fasta
Posted date: May 2, 2006 2:53 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 110,918
Number of Sequences: 1013581
Number of extensions: 110918
Number of successful extensions: 8811
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8607
Number of HSP's gapped (non-prelim): 204
length of query: 352
length of database: 908,940,872
effective HSP length: 19
effective length of query: 333
effective length of database: 889,682,833
effective search space: 296264383389
effective search space used: 296264383389
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)