BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE20c02.yg.2.1
(696 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|Z34866.1|Z34866 ATTS3595 Strasbourg-A Arabidopsis thalia... 54 3e-005
gb|BE662776.1|BE662776 EST00519 Arabidopsis Chronic Ozone F... 54 3e-005
gb|AF360240.1| Arabidopsis thaliana At3g18080 mRNA sequence 54 3e-005
gb|AY084864.1| Arabidopsis thaliana clone 11984 mRNA, compl... 54 3e-005
emb|BX823566.1|CNS0A5AM Arabidopsis thaliana Full-length cD... 54 3e-005
emb|BX824102.1|CNS0A5R3 Arabidopsis thaliana Full-length cD... 54 3e-005
ref|NM_112690.2| Arabidopsis thaliana hydrolase, hydrolyzin... 54 3e-005
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 46 0.008
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.032
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 42 0.13
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 42 0.13
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 42 0.13
emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.50
emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.50
gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Rev... 40 0.50
gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Rev... 40 0.50
gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Rev... 40 0.50
gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone For... 40 0.50
gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseud... 40 0.50
gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudo... 40 0.50
gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudo... 40 0.50
gb|CB074186.1|CB074186 EST02508 Early Ovule Development For... 40 0.50
gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasi... 40 0.50
gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasi... 40 0.50
gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasi... 40 0.50
gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasi... 40 0.50
gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone poo... 40 0.50
gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasi... 40 0.50
gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasi... 40 0.50
gb|BX836891.1|BX836891 BX836891 Arabidopsis thaliana Adult ... 40 0.50
gb|AV552434.1|AV552434 AV552434 Arabidopsis thaliana roots ... 40 0.50
gb|AV561121.1|AV561121 AV561121 Arabidopsis thaliana green ... 40 0.50
gb|CK121800.1|CK121800 201n23.p1 AtM1 Arabidopsis thaliana ... 40 0.50
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 40 0.50
gb|AY045927.1| Arabidopsis thaliana putative beta-glucosida... 40 0.50
gb|AY045953.1| Arabidopsis thaliana putative beta-glucosida... 40 0.50
gb|AY113935.1| Arabidopsis thaliana putative beta-glucosida... 40 0.50
gb|AY142610.1| Arabidopsis thaliana putative beta-glucosida... 40 0.50
emb|AX507774.1| Sequence 2469 from Patent WO0216655 40 0.50
gb|AY085043.1| Arabidopsis thaliana clone 125606 mRNA, comp... 40 0.50
gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis th... 40 0.50
emb|BX824238.1|CNS0A5LH Arabidopsis thaliana Full-length cD... 40 0.50
emb|BX814106.1|CNS0AC9Y Arabidopsis thaliana Full-length cD... 40 0.50
dbj|AB020749.1| Arabidopsis thaliana genomic DNA, chromosom... 40 0.50
emb|AJ838785.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.50
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 40 0.50
ref|NM_102418.2| Arabidopsis thaliana hydrolase, hydrolyzin... 40 0.50
ref|NM_115876.3| Arabidopsis thaliana hydrolase, hydrolyzin... 40 0.50
ref|NM_001035822.1| Arabidopsis thaliana hydrolase, hydroly... 40 0.50
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 40 0.50
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.50
>gb|Z34866.1|Z34866 ATTS3595 Strasbourg-A Arabidopsis thaliana cDNA clone FAFL76 5',
mRNA sequence
Length = 305
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 98 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 39
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 38 catccgatatggaagtctcttgctctttgagctgc 4
>gb|BE662776.1|BE662776 EST00519 Arabidopsis Chronic Ozone Forward-Subtracted Library
Arabidopsis thaliana cDNA clone AtCOzIC6, mRNA sequence
Length = 709
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 213 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 272
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 273 catccgatatggaagtctcttgctctttgagctgc 307
>gb|AF360240.1| Arabidopsis thaliana At3g18080 mRNA sequence
Length = 1845
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 1065 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 1006
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 1005 catccgatatggaagtctcttgctctttgagctgc 971
>gb|AY084864.1| Arabidopsis thaliana clone 11984 mRNA, complete sequence
Length = 1739
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 992 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 933
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 932 catccgatatggaagtctcttgctctttgagctgc 898
>emb|BX823566.1|CNS0A5AM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS51ZD02 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1737
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 983 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 924
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 923 catccgatatggaagtctcttgctctttgagctgc 889
>emb|BX824102.1|CNS0A5R3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH22ZC05 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1704
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 977 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 918
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 917 catccgatatggaagtctcttgctctttgagctgc 883
>ref|NM_112690.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT3G18080 mRNA, complete cds
Length = 1894
Score = 54.0 bits (27), Expect = 3e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggatattgcccatttattaatggatcaagaaac 338
||||||||||||| |||||| |||||||||| | |||| || |||||| | || ||||
Sbjct: 992 tctttcacaatgttctgcattgtctttggatactctccatatactaatgggtgaataaac 933
Query: 339 caaccaatatggaagtccctggccctttgcgctgc 373
|| || ||||||||||| || || ||||| |||||
Sbjct: 932 catccgatatggaagtctcttgctctttgagctgc 898
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
sequence
Length = 358
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtacttt 23
|||||||||||||||||||||||
Sbjct: 348 gcggccgcccgggcaggtacttt 326
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
genomic survey sequence
Length = 378
Score = 44.1 bits (22), Expect = 0.032
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtactt 22
||||||||||||||||||||||
Sbjct: 32 gcggccgcccgggcaggtactt 53
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EB10, mRNA sequence
Length = 406
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtact 21
|||||||||||||||||||||
Sbjct: 401 gcggccgcccgggcaggtact 381
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH04 similar to PsbA gene in chloroplast
genome, mRNA sequence
Length = 360
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtact 21
|||||||||||||||||||||
Sbjct: 351 gcggccgcccgggcaggtact 331
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtact 21
|||||||||||||||||||||
Sbjct: 142 gcggccgcccgggcaggtact 122
>emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequence GK-708H07-022965,
genomic survey sequence
Length = 416
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 33 gcggccgcccgggcaggtac 52
>emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequence GK-712A09-022963,
genomic survey sequence
Length = 278
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 218 gcggccgcccgggcaggtac 199
>gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA7 similar to
small nuclear ribosomal protein E, mRNA sequence
Length = 263
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 258 gcggccgcccgggcaggtac 239
>gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA9, mRNA sequence
Length = 328
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 323 gcggccgcccgggcaggtac 304
>gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtaOzHC2 similar to
Lhca2 chlorophyll a/b-binding protein, mRNA sequence
Length = 450
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 62 gcggccgcccgggcaggtac 81
>gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone Forward-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzD61, mRNA sequence
Length = 255
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 189 gcggccgcccgggcaggtac 170
>gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone AVR2-A8 similar
to hypothetical protein targeted to chloroplast, mRNA
sequence
Length = 456
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 455 gcggccgcccgggcaggtac 436
>gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC4-H4 similar
to putative protein with homology to rubisco small
subunit, mRNA sequence
Length = 370
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 65 gcggccgcccgggcaggtac 84
>gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC1-C2 similar
to putative tyrosine aminotransferase, mRNA sequence
Length = 579
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 40 gcggccgcccgggcaggtac 59
>gb|CB074186.1|CB074186 EST02508 Early Ovule Development Forward Subtracted Library
Arabidopsis thaliana cDNA clone 1D17G5 similar to blue
copper protein, mRNA sequence
Length = 149
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 14 gcggccgcccgggcaggtac 33
>gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RAA10 similar to chlorophyll a/b-binding
protein, mRNA sequence
Length = 527
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 385 gcggccgcccgggcaggtac 366
>gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RBC07 similar to PSI subunit, mRNA sequence
Length = 249
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 243 gcggccgcccgggcaggtac 224
>gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-BB7 similar to PUTATIVE PROTEIN, mRNA sequence
Length = 320
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 232 gcggccgcccgggcaggtac 213
>gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-FF9 similar to UNKNOWN PROTEIN, mRNA sequence
Length = 421
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 416 gcggccgcccgggcaggtac 397
>gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH10 similar to putative protein, mRNA
sequence
Length = 305
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 297 gcggccgcccgggcaggtac 278
>gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-AA5 similar to NAD dependent epimerase, mRNA
sequence
Length = 601
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 471 gcggccgcccgggcaggtac 452
>gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EH12 similar to putative protein, mRNA
sequence
Length = 271
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 266 gcggccgcccgggcaggtac 247
>gb|BX836891.1|BX836891 BX836891 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS66ZC05 5PRIM, mRNA
sequence
Length = 876
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 557 cctttctgagttgcctggta 538
>gb|AV552434.1|AV552434 AV552434 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ29e08R 5', mRNA sequence
Length = 434
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 148 cctttctgagttgcctggta 129
>gb|AV561121.1|AV561121 AV561121 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ146c04F 3', mRNA sequence
Length = 446
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 378 caacaatgtaaggctcggtcgatgagtt 351
>gb|CK121800.1|CK121800 201n23.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011N23201
5-PRIME, mRNA sequence
Length = 744
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 638 cctttctgagttgcctggta 619
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 9189081 caacaatgtaaggctcggtcgatgagtt 9189054
>gb|AY045927.1| Arabidopsis thaliana putative beta-glucosidase (At1g26560) mRNA,
complete cds
Length = 1779
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 847 caacaatgtaaggctcggtcgatgagtt 820
>gb|AY045953.1| Arabidopsis thaliana putative beta-glucosidase (At3g60130) mRNA,
complete cds
Length = 1770
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 829 cctttctgagttgcctggta 810
>gb|AY113935.1| Arabidopsis thaliana putative beta-glucosidase (At3g60130) mRNA,
complete cds
Length = 1576
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 788 cctttctgagttgcctggta 769
>gb|AY142610.1| Arabidopsis thaliana putative beta-glucosidase (At1g26560) mRNA,
complete cds
Length = 1562
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 712 caacaatgtaaggctcggtcgatgagtt 685
>emb|AX507774.1| Sequence 2469 from Patent WO0216655
Length = 238
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 5 gcggccgcccgggcaggtac 24
>gb|AY085043.1| Arabidopsis thaliana clone 125606 mRNA, complete sequence
Length = 1767
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 841 caacaatgtaaggctcggtcgatgagtt 814
>gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis thaliana chromosome 1, complete
sequence
Length = 89473
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 19969 caacaatgtaaggctcggtcgatgagtt 19996
>emb|BX824238.1|CNS0A5LH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH31ZH11 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1724
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 864 cctttctgagttgcctggta 845
>emb|BX814106.1|CNS0AC9Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB57ZF10 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1445
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 549 caacaatgtaaggctcggtcgatgagtt 522
>dbj|AB020749.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8
Length = 76816
Score = 40.1 bits (20), Expect = 0.50
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggata 310
||||||||||||| |||||| ||||||||||
Sbjct: 22170 tctttcacaatgttctgcattgtctttggata 22139
>emb|AJ838785.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
405F08
Length = 664
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 3 ggccgcccgggcaggtactt 22
||||||||||||||||||||
Sbjct: 151 ggccgcccgggcaggtactt 132
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 40.1 bits (20), Expect = 0.50
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggata 310
||||||||||||| |||||| ||||||||||
Sbjct: 6167475 tctttcacaatgttctgcattgtctttggata 6167444
>ref|NM_102418.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT1G26560 mRNA, complete cds
Length = 1776
Score = 40.1 bits (20), Expect = 0.50
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 514 caacaatgtaaggttctgtcgatgagtt 541
||||||||||||| || |||||||||||
Sbjct: 847 caacaatgtaaggctcggtcgatgagtt 820
>ref|NM_115876.3| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT3G60130 transcript variant AT3G60130.1 mRNA, complete
cds
Length = 1811
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 864 cctttctgagttgcctggta 845
>ref|NM_001035822.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT3G60130 transcript variant AT3G60130.2 mRNA, complete
cds
Length = 1562
Score = 40.1 bits (20), Expect = 0.50
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 441 cctttctgagttgcctggta 460
||||||||||||||||||||
Sbjct: 638 cctttctgagttgcctggta 619
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 40.1 bits (20), Expect = 0.50
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 279 tctttcacaatgtcttgcattatctttggata 310
||||||||||||| |||||| ||||||||||
Sbjct: 6193178 tctttcacaatgttctgcattgtctttggata 6193147
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 252,732
Number of Sequences: 1013581
Number of extensions: 252732
Number of successful extensions: 19297
Number of sequences better than 0.5: 52
Number of HSP's better than 0.5 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18797
Number of HSP's gapped (non-prelim): 500
length of query: 696
length of database: 908,940,872
effective HSP length: 20
effective length of query: 676
effective length of database: 888,669,252
effective search space: 600740414352
effective search space used: 600740414352
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)