BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAD12g05.sg.3.2
         (900 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AQ960678.1|AQ960678  LERFG51TR LERA Arabidopsis thaliana ...    42   0.16 
gb|CB252738.1|CB252738  19-E010740-019-001-E15-T7R MPIZ-ADIS...    42   0.16 
gb|AC007659.2|AC007659  Arabidopsis thaliana chromosome II s...    42   0.16 
emb|BX821417.1|CNS0A884  Arabidopsis thaliana Full-length cD...    42   0.16 
gb|BT020235.1|  Arabidopsis thaliana At2g45130 gene, complet...    42   0.16 
ref|NM_130076.2|  Arabidopsis thaliana unknown protein AT2G4...    42   0.16 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    42   0.16 
>gb|AQ960678.1|AQ960678 LERFG51TR LERA Arabidopsis thaliana genomic clone LERFG51, DNA
           sequence
          Length = 771

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 tttgatgaagtttggaaagag 396
           |||||||||||||||||||||
Sbjct: 736 tttgatgaagtttggaaagag 756
>gb|CB252738.1|CB252738 19-E010740-019-001-E15-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
           clone MPIZp768E151Q 5-PRIME, mRNA sequence
          Length = 452

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 tttgatgaagtttggaaagag 396
           |||||||||||||||||||||
Sbjct: 274 tttgatgaagtttggaaagag 294
>gb|AC007659.2|AC007659 Arabidopsis thaliana chromosome II section 241 of 255 of the complete
             sequence. Sequence from clones T13E15, T14P1
          Length = 87885

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 376   tttgatgaagtttggaaagag 396
             |||||||||||||||||||||
Sbjct: 72113 tttgatgaagtttggaaagag 72133
>emb|BX821417.1|CNS0A884 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL3ZG07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 915

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 tttgatgaagtttggaaagag 396
           |||||||||||||||||||||
Sbjct: 74  tttgatgaagtttggaaagag 94
>gb|BT020235.1| Arabidopsis thaliana At2g45130 gene, complete cds
          Length = 911

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 tttgatgaagtttggaaagag 396
           |||||||||||||||||||||
Sbjct: 75  tttgatgaagtttggaaagag 95
>ref|NM_130076.2| Arabidopsis thaliana unknown protein AT2G45130 mRNA, complete cds
          Length = 916

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 tttgatgaagtttggaaagag 396
           |||||||||||||||||||||
Sbjct: 76  tttgatgaagtttggaaagag 96
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 376      tttgatgaagtttggaaagag 396
                |||||||||||||||||||||
Sbjct: 18613560 tttgatgaagtttggaaagag 18613580
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 373,035
Number of Sequences: 1013581
Number of extensions: 373035
Number of successful extensions: 28022
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27878
Number of HSP's gapped (non-prelim): 144
length of query: 900
length of database: 908,940,872
effective HSP length: 20
effective length of query: 880
effective length of database: 888,669,252
effective search space: 782028941760
effective search space used: 782028941760
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)