BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAD12g05.sg.3.2
(900 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AQ960678.1|AQ960678 LERFG51TR LERA Arabidopsis thaliana ... 42 0.16
gb|CB252738.1|CB252738 19-E010740-019-001-E15-T7R MPIZ-ADIS... 42 0.16
gb|AC007659.2|AC007659 Arabidopsis thaliana chromosome II s... 42 0.16
emb|BX821417.1|CNS0A884 Arabidopsis thaliana Full-length cD... 42 0.16
gb|BT020235.1| Arabidopsis thaliana At2g45130 gene, complet... 42 0.16
ref|NM_130076.2| Arabidopsis thaliana unknown protein AT2G4... 42 0.16
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.16
>gb|AQ960678.1|AQ960678 LERFG51TR LERA Arabidopsis thaliana genomic clone LERFG51, DNA
sequence
Length = 771
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 736 tttgatgaagtttggaaagag 756
>gb|CB252738.1|CB252738 19-E010740-019-001-E15-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768E151Q 5-PRIME, mRNA sequence
Length = 452
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 274 tttgatgaagtttggaaagag 294
>gb|AC007659.2|AC007659 Arabidopsis thaliana chromosome II section 241 of 255 of the complete
sequence. Sequence from clones T13E15, T14P1
Length = 87885
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 72113 tttgatgaagtttggaaagag 72133
>emb|BX821417.1|CNS0A884 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL3ZG07 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 915
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 74 tttgatgaagtttggaaagag 94
>gb|BT020235.1| Arabidopsis thaliana At2g45130 gene, complete cds
Length = 911
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 75 tttgatgaagtttggaaagag 95
>ref|NM_130076.2| Arabidopsis thaliana unknown protein AT2G45130 mRNA, complete cds
Length = 916
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 76 tttgatgaagtttggaaagag 96
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 376 tttgatgaagtttggaaagag 396
|||||||||||||||||||||
Sbjct: 18613560 tttgatgaagtttggaaagag 18613580
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 373,035
Number of Sequences: 1013581
Number of extensions: 373035
Number of successful extensions: 28022
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27878
Number of HSP's gapped (non-prelim): 144
length of query: 900
length of database: 908,940,872
effective HSP length: 20
effective length of query: 880
effective length of database: 888,669,252
effective search space: 782028941760
effective search space used: 782028941760
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)